ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ
УДК 581.1
A Splicing Site Mutation in BrpFLCl and Repressed Expression of BrpFLC Genes Are Associated with the Early Flowering
of Purple Flowering Stalk
© 2011 G. L. Hu, Z. L. Hu, Y. Li, F. Gu, Z. P. Zhao, G. P. Chen
Key Laboratory of Biorheological Science and Technology, Chongqing University, Ministry of Education, Bioengineering
College, Chongqing University, Chongqing, P. R. China Received August 14, 2010
FLOWERING LOCUS C (FLC), which encodes a MADS-box domain protein, is a flowering repressor involved in the key position of Arabidopsis (Arabidopsis thaliana) flowering network. In Brassica species, several FLC homologues are involved in flowering time like Arabidopsis FLC. Here, we report the analysis of splicing variation in BrpFLC1 and the expression of BrpFLC homologues associated with early flowering of Purple Flowering Stalk (Brassica campestris L. ssp. chinensis L. var. purpurea Bailey). It was indicated that a splice site mutation happened in intron 6 with G to A at the 5' splice site. Three alternative splicing patterns of BrpFLC1, including the entire exon 6 excluded and 24 bp or 87 bp of intron 6 retained, were identified in Purple Flowering Stalk. But there was only one normal splicing pattern in Pakchoi (Brassica campestris ssp. chinensis var. communis). Northern blotting and semi-quantitative RT-PCR revealed that the expression levels of the three FLC homologues in Purple Flowering Stalk were lower than that in Pakchoi. However, the expression levels of downstream genes, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) and FLOWERING LOCUS T (FT), were higher in Purple Flowering Stalk. These results suggest that a natural splicing site mutation in BrpFLC1 gene and repressed expression of all BrpFLC genes contribute significantly to flowering time variation in Purple Flowering Stalk.
Keywords: Brassica campestris ssp. chinensis var. purpurea — BrpFLCl — splicing variation — BrpFLC — repressed expression
INTRODUCTION
The transition from vegetative to reproductive development is an important step in plant growth for flowering plants. The timing of this step is regulated by numerous factors, including endogenous cues and environmental stimuli [1]. It has been suggested that Arabidopsis flowering is regulated by four major pathways, including the photoperiod, vernalization, GA pathway, and autonomous pathway [2]. These multiple pathways are integrated to control the expression of flowering-time integrator genes, such as SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) and FLOWERING LOCUS T (FT), which promote flowering by activating floral meristem-identity genes, LEAFY and APETALA 1 (API) [2]. The autonomous signaling pathway and signals from vernalization pathway converge at the gene FLOWERING LO-CUSC (FLC), which encodes a MADS-box transcrip-
Abbreviations: At — Arabidopsis thaliana; Bn — Brassica napus; Bo — Brassica oleracea; Br — Brassica rapa; Brp — Brassica campestris L. ssp. chinensis L. var. purpurea Bailey; FLC - FLOWERING LOCUS C. Corresponding author: Guoping Chen. Bioengineering college, Chongqing University, Campus A, 174 Shapingba Main Str., Chongqing 400044, P. R. China. Fax: 0086-23-6511-2674; e-mail: chenguoping@ cqu.edu.cn
tion factor and acts as a repressor of the floral transition in a dosage-dependent manner [3, 4]. FLC represses FT and SOC1 in leaves and shoot apices by binding to a region of the first intron of FT that contains a putative CArG box and a region of the promoter of SOC1 gene that contains a CArG box [5]. Genes in autonomous pathway, which encode two general classes of proteins, including RNA-binding proteins and chromatin remodeling factors, suppress the expression of FLC by modifying chromatin and regulating the pre-mRNA of FLC [6]. Vernalization pathway represses the expression of FLC through modification of FLC chromatin and promotes flowering in vernalization-responsive late-flowering plants [4]. Genes involved in vernalization pathway, such as VERNALIZATION INSENSITIVE 3 (VIN3), VERNALIZATION 2 (VRN2), VERNALIZATION 1 (VRN1) and genes encoding other VIN3-like proteins, repress FLC expression and induce flowering [7].
Arabidopsis FLC encodes a novel MADS domain protein that acts as a repressor of flowering [2]. Besides FLC, the MADS-domain-protein family contains other five MADS AFFECTING FLOWERING proteins (MAF1-5) with 53-87% identity to FLC [8].
Fig. 1. Natural early-flowering mutant Purple Flowering
Stalk (Brassica campestris L. ssp. chinensis L. var. purpurea
Bailey) and the late-flowering phenotype Pakchoi (B.
campestris ssp. chinensis var. communis).
Genes homologous to FLC play major role in the vernalization response in Brassica species [9]. Many genes homologous to AtFLC have been isolated from Brassica species and characterized. Five FLC-related homologues (BnFLC1-5), isolated from B. napus, delay flowering significantly when they are overexpressed in Arabidopsis [10]. Four homologues of AtFLC (BrFLC1, BrFLC2, BrFLC3, and BrFLC5) cosegregate with important loci that determine flowering time in late-flowering ecotypes of B. rapa [11]. Five homologues of AtFLC (BoFLC1, BoFLC2, BoFLC3, BoFLC4, and BoFLC5) have been isolated from cabbage (B. oleracea), and the expression patterns of BoFLC3-2 and BoFLC4-1 were analyzed by using reporter gene in Arabidopsis [1, 11, 12]. Three genes homologous to the AtFLC gene (BrFLC1, BrFLC2, and BrFLC3) are gained from Chinese cabbage (Brassica rapa L. ssp. pekinensis), and the constitutive expression of the BrFLC genes in Arabidopsis significantly delays flowering. It can be also observed the late flowering phenotype in transgenic Chinese cabbage by overexpressing BrFLC3 [1]. These results indicate that FLC homologs of Brassica species act similarly to AtFLC and play a great role as repressors of flowering.
Genetic analysis has revealed that differences in flowering time between early-flowering and late-flowering ecotypes are largely dependent on allelic variation in FLC [3, 13]. Plant genes contain conserved 5' splice sites (exon/intron junction AG/GTAAG) and 3' splice sites (intron/exon junction TGCAG/G). Mutations in splice site could always result in mis-splicing in the transcripts, including intron retention or exon deletion [14]. Michaels et al. [3] reported that flc-3 contained a 104-bp deletion that removed the start codon; flc-4 contained a 7-bp deletion that resulted in a frame shift after the first 20 amino acids; and flc-1
contained a single-base transition at the first exon in-tron junction that changed the conserved GT donor site to AT and presumably disrupted splicing. Slotte et al. [15] also identified splicing variation at a FLOWERING LOCUS C homologue that was associated with flowering time variation in the tetraploid Capsella bursa-pastoris (L.) Medic. Consequently, these previous studies indicate that the splice site mutations in FLC homologues play a significant role in impact on flowering time.
Purple Flowering Stalk (Brassica campestris L. ssp. chinensis L. var. purpurea Bailey) is one of the most popular vegetable crops in south of China (fig. 1). It has been cultivated more than one thousand years and wins people's affection. Unlike other Brassica species, such as Pakchoi (Brassica campestris ssp. chinensis var. communis), which is a vernalization-responsive type plant (fig. 1), Purple Flowering Stalk flowers early without vernalization. Compared with Pakchoi, Purple Flowering Stalk is a type of natural early flowering mutant. However, little attention has been paid to understand the molecular mechanism of flowering earlier in Purple Flowering Stalk.
In this study, we isolated three FLC homologues from Purple Flowering Stalk and detected the expression patterns of FLC homologues. Our results showed that a naturally occurring splicing site mutation G to A in intron 6 of BrpFLC1 resulted in three alternative splicing patterns in Purple Flowering Stalk. This mutation caused the translation of BrpFLC1 terminating earlier than normal translation and generating abnormal BrpFLC1 protein. Besides, the expression levels of FLC homologues were lower in Purple Flowering Stalk than that in Pakchoi. Our results suggest that a natural splicing site mutation in BrpFLC1 gene and repressed expression of all BrpFLC genes might be the major putative reason for the early flowering of Purple Flowering Stalk.
MATERIALS AND METHODS
Plant materials and growth conditions. Early-flowering Purple Flowering Stalk (Brassica campestris L. ssp. chinensis L. var. purpurea Bailey) named "xiang-hong" and late-flowering Pakchoi (B. campestris ssp. chinensis var. communis) named "shanghaiqing" were used in this study. For unvernalization treatment, Purple Flowering Stalk and Pakchoi were grown in a culture room under long days at 25°C for 20 days and collected at the same time. The whole plantlets were collected to extract RNA to analyze the differential expression of FLC homologues between Purple Flowering Stalk and Pakchoi, and roots, stems, leaves, and cotyledon of Purple Flowering Stalk were collected separately to extract RNA for the analysis of differential expression of FLC homologues in different tissues. For the vernalization treatment, plants were grown in long day at 25°C for 2 days to germinate and then
Primers used for amplification of FLC homologues and Semi-quantitative RT-PCR
Primer Primer sequence Orientation
BrpFLC1-F 5'-CGCAAAGCACTGTTGGAGA-3' sense
BrpFLCl-R 5'-TCGGAGATTTGTCCTGGTGAG-3' antisense
BrpFLC2-F 5 '-GCCATGGGAAGAAAGAAACTAGAG -3' sense
BrpFLC2-R 5 '-AAGCTTGGATCCGAATTCTTTTTTTTTTTTTTTTTT-3' antisense
BrpFLC3-F 5'-TTGATGTCGGAGATTTGTCC-3' sense
BrpFLC3-R 5 '-GGACAAATCTCCGACATCAA-3' antisense
BrpFLC1-GF 5'-CTTGAGGAATCAAATGTCGATAA-3' sense
BrpFLC1-GR 5'-CCATATTATCAGCTTCGGCTCG-3' Antisense
FLC1-F 5'-TCTAAACGACGCAACGGTCTCAT-3' sense
FLC1-R 5 ' - GTTGCTTTCCATATCGATCAAGG - 3 ' antisense
FLC2-F 5'-CT TCTCCAAACGACGCAAT-3' sense
FLC2-R 5'-TCTAGTT
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.