научная статья по теме АКТИВНОСТЬ И ЭКСПРЕССИЯ ГЕНОВ ЛАККАЗЫ, ТИРОЗИНАЗЫ, ГЛЮКАНАЗЫ И ХИТИНАЗЫ В ПРОЦЕССЕ МОРФОГЕНЕЗА LENTINUS EDODES Биология

Текст научной статьи на тему «АКТИВНОСТЬ И ЭКСПРЕССИЯ ГЕНОВ ЛАККАЗЫ, ТИРОЗИНАЗЫ, ГЛЮКАНАЗЫ И ХИТИНАЗЫ В ПРОЦЕССЕ МОРФОГЕНЕЗА LENTINUS EDODES»

МИКРОБИОЛОГИЯ, 2015, том 84, № 1, с. 78-89

ЭКСПЕРИМЕНТАЛЬНЫЕ ^^^^^^^^^^^^ СТАТЬИ

УДК 577.151

АКТИВНОСТЬ И ЭКСПРЕССИЯ ГЕНОВ ЛАККАЗЫ, ТИРОЗИНАЗЫ, ГЛЮКАНАЗЫ И ХИТИНАЗЫ В ПРОЦЕССЕ МОРФОГЕНЕЗА

LENTINUS EDODES

© 2015 г. Е. П. Ветчинкина*, 1, В. Ю. Горшков*, М. В. Агеева**, Ю. В. Гоголев**, В. Е. Никитина**

*Институт биохимии и физиологии растений и микроорганизмов РАН, Саратов **Казанский институт биохимии и биофизики КазНЦРАН Поступила в редакцию 08.04.2014 г.

Установлено, что при культивировании ксилотрофного базидиомицета Lentinus edodes на древесном субстрате, при переходе от вегетативной стадии развития к генеративной, активируется экспрессия генов lcc4 и tir, кодирующих ферменты лакказы и тирозиназы. Особенно это характерно для коричневой мицелиальной пленки — стадии, предшествующей плодоношению. Показано, что при образовании этой морфоструктуры резко повышается активность лакказы и тирозиназы, а также происходят перестройки в составе фенолоксидазного комплекса. У штамма с нарушенным циклом развития уровень экспрессии генов фенолоксидаз значительно снижен. При образовании тканей с утолщенной клеточной стенкой наблюдается повышение экспрессии генов chi и exgl, кодирующих хитиназу и глюканазу. Экзогенное воздействие препарата лакказы, полученного из коричневой мицелиальной пленки, на вегетативный мицелий ускоряет образование указанной морфоструктуры. Активация генов lcc4, tir, chi и exgl может служить маркером готовности ксилотрофных грибов к плодоношению.

Ключевые слова: морфогенез базидиомицетов, коричневая мицелиальная пленка, ЬепИпш edodes, экспрессия генов, белки-маркеры.

DOI: 10.7868/S0026365615010164

Базидиомицет Lentinus edodes (шиитаке) представляет интерес, обусловленный большой пищевой ценностью и вкусовыми качествами плодовых тел, а также наличием уникального комплекса биологически активных и лекарственных веществ, на основе которых был запатентован ряд высокоэффективных противоопухолевых, антисклеротических, антивирусных медицинских препаратов, характеризующихся высоким терапевтическим эффектом и не оказывающих отрицательного воздействия на организм человека [1, 2]. Шиитаке относится к ксилотрофам — деструкторам древесины, и в качестве пищевых субстратов для культивирования этих грибов можно использовать отходы лесной и деревообрабатывающей промышленности [3].

Несмотря на очевидную актуальность и практическую значимость, вопрос о возможной оптимизации искусственного выращивания ценных съедобных и лекарственных базидиомицетов до настоящего времени окончательно не решен. Од-

1 Автор для корреспонденции (e-mail: elenavetrus@yan-dex.ru).

на из главных причин заключается в особенностях жизненного цикла макромицетов, кардинально отличающегося от растений и микроорганизмов, и недостаточной изученности молекулярно-физио-логических аспектов морфогенеза.

Исследования, направленные на изучение морфогенеза растений, указывают на взаимосвязь между изменениями в белковом составе тканей и формированием организованных структур. Например, повышение общего синтеза белков предшествует инициации образования почек [4]. Для некоторых растений проведен сравнительный анализ полипептидных спектров морфогенных и неморфогенных культур, на основании чего был выявлен ряд различий и обнаружены белки-маркеры, ответственные за прохождение отдельных этапов морфогенеза [5]. Интерес вызывает появление специфических полипептидов, образование которых связывают с проявлением способности к морфогенезу. Отмечается, что обнаруженные белки ответственны за прохождение отдельных этапов развития и могут участвовать в морфогенезе как маркеры клеточной идентичности или даже как регуляторные молекулы [6]. Особое внимание уде-

ляется "генам-переключателям" развития и продуктам их экспрессии, которым отводится основная роль в пространственно-временной регуляции процессов морфогенеза [7, 8].

В подавляющем большинстве работ, посвященных базидиомицетам, описываются специальные технологии и подходы к процессу культивирования грибов, совершенствуются методы обнаружения и выделения ферментов и биологически активных веществ из мицелия и плодовых тел, но не затрагиваются функциональные биохимические аспекты роста и развития. Исследование генов и белков в связи с регуляцией роста и морфообразо-вания высших грибов, выявление специфичных белков, сопутствующих морфогенетическим процессам, изучение ультраструктурной морфологии грибных гиф в процессе развития, вызывает несомненный интерес и позволит расширить представления о факторах, определяющих формирование плодовых тел лекарственных съедобных макромицетов, что, несомненно, найдет в дальнейшем практическое применение.

Базидиомицет L. edodes в процессе развития образует хорошо дифференцированные морфо-структуры: вегетативный непигментированный мицелий, коричневую мицелиальную пленку (КМП), примордии и плодовые тела [9]. Результаты наших предыдущих исследований показали существенные изменения внутриклеточного полипептидного состава в зависимости от стадии морфогенеза [10]. Наиболее выраженные различия были в тканях коричневой мицелиальной пленки, структуры, предварительное образование которой необходимо для формирования полноценных плодовых тел шиитаке. Специфичные белки, характерные для данного морфообразова-ния, могут выступать как функциональные молекулы, осуществляющие инициацию перехода от вегетативных стадий развития гриба к генеративным.

Цель исследования — изучение транскрипционной активности генов и выявление функциональных белков-маркеров, лакказы, тирозиназы, глюканазы и хитиназы, выявление изменений в фенол-оксидазном комплексе и ультраструктурной морфологии грибных гиф в процессе цитодиффе-ренцировки Lentinus edodes.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Организмы и условия культивирования. В работе использовали 3 штамма ксилотрофного бази-диомицета Lentinus edodes (Berk.) Sing [Lentinula edodes (Berk.) Pegler] (шиитаке): штаммы F-249 и 2-Т из коллекции высших базидиальных грибов кафедры микологии и альгологии МГУ им. М.В. Ломоносова, а также штамм 363, полученный из коллекции шляпочных грибов Института ботаники

им. Н.Г. Холодного НАН Украины. Грибы выращивали на косяках с агаризованным пивным суслом (4° по Баллингу) в течение 14 сут при 26°С, хранили при 4°С. В качестве инокулята брали 14-сут культуру, выращенную на агаризо-ванном пивном сусле при 26°С.

Базидиомицеты выращивали интенсивным способом, наиболее приближенным к естественному, на древесном субстрате в лабораторных условиях [9]. В качестве исследуемого материала использовали рыхлый и плотный непигментиро-ванный мицелий, коричневую мицелиальную пленку, примордии и плодовые тела L. edodes.

Выделение РНК и синтез кДНК при помощи реакции обратной транскрипции. Ткани вышеперечисленных морфоструктур трех штаммов L. edodes отдельно собирали, мгновенно замораживали и гомогенизировали, растирая в фарфоровой ступке в жидком азоте. Выделение тотальной РНК из грибных клеток, проводили при помощи коммерческого набора RNeasy Plant Mini Kit ("Qiagen", США), согласно протоколу производителя. Концентрацию РНК определяли спектрофотометри-чески на приборе NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA). Качество выделенной РНК оценивали по спектрам электро-форетического разделения в 1% агарозном геле после окрашивания бромистым этидием [11].

Для получения кДНК использовали 1.5 мкг тотальной РНК, предварительно обработанной 0.1ед/мкл ДНКазой ("Fermentas", Литва) при 37°С в течение 30 мин. Реакцию обратной транскрипции проводили в реакционной смеси объемом 25 мкл, содержащей 100 мкМ праймеров оли-ro-dT18, 300 мкМ дезоксирибонуклеотидфосфа-тов, 100 ед ревертазы M-MuLV ("Fermentas", Литва) с соответствующим буфером. На первой стадии раствор РНК в присутствии олигонуклео-тидных затравок (олиго-ёТ18) прогревали при 70°С в течение 5 мин, а затем помещали на лед. На второй стадии добавляли остальные компоненты и инкубировали при 37°С в амплификаторе DNA Engine thermocycler ("Bio-Rad", Hercules, CA, США) в течение 1 ч. Реакцию терминировали прогреванием смеси до 70°С в течение 10 мин; 2 мкл полученной кДНК использовали для проведения ПЦР.

Амплификация участков ДНК L. edodes с помощью полимеразной цепной реакции в реальном времени (ПЦР РВ). Для амплификации участков ДНК (кДНК) L. edodes нами были сконструированы праймеры, комплементарные фрагментам генов lcc4, tir, chi, exgl и gpd, кодирующих лакказу, тирозиназу, хитиназу, глюканазу и глицеральде-гид-3-фосфат дегидрогеназу соответственно. Последний ген был использован в качестве референтного.

Конструирование праймеров и олигонуклео-тидных флуоресцентных зондов TaqMan прово-

80 ВЕТЧИНКИНА и др.

Таблица. Список сконструированных праймеров и флуоресцентных зондов TaqMan

Праймеры и зонды Последовательность 5'-3'

gpd F gACgCACTgACAATCTgACTg

gpd R gATgCgAgAgTTCAggTTTTAC

gpd Z (FAM-C)CCTgTCCgAg(T-BHQ-1)CCTTTCCgTgATAC

exgl F CggggTAAgTTCTCCTCCAAg

exgl R gAACgAgTAggACgAACCATg

exg1 Z (FAM-C)TgggCg(T BHQ-1)TTgAAgTTggTCCg

chi F CTTCgggAgCCTATgTAACTgTg

chi R CCAggCTTTCCAATgATTACTgC

chi Z (FAM-C)ACTACC(T-BHQ-1)gCgACgggCTCC

lcc4 F CAggCACCCCAgCAAATgACC

lcc4 R CggCACgCTgggAgACACAAAg

lcc4 Z (FAM-C)gTAACCA(T-BHQ-1)CgCACCATCATCATCgggg

tir F GCCCAGGTTGATCGTCTGCTTTC

tir R CTGCCAATGTGACCGATACGTCC

tir Z (FAM-C)ATGGACTA(T-BHQ-1)CCCTCCCGACACTGTAGTTGGAAAG

дили при помощи пакета программ Vector NTI версия 9 на основе нуклетидных последовательностей L. edodes [12]. Поскольку информация о последовательности в генах генома шиитаке в базах данных крайне ограничена, в ряде случаев ее недостаток удавалось восполнить построением консенсусных последовательностей кодирующих областей генов с использованием базы данных по другим видам базидиомицетов. Праймеры и флуоресцентные зонды синтезировали в НПО "Син-тол", (Москва).

Список сконструированных праймеров и флуоресцентных зондов TaqMan представлен в таблице.

ПЦР проводили в реакционной смеси объемом 25 мкл, содержащей буфер (67 мМ трис-HCl, рН 8.8, 17 мМ (NH4)2SO4, 2.5 мМ MgCl2 и 0.1% Tween 20), 100 мкМ каждого из дезоксирибонук-леозидтрифосфато

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»