научная статья по теме АЛЬГО-БАКТЕРИАЛЬНЫЕ СООБЩЕСТВА СОДОВЫХ ОЗEР КУЛУНДИНСКОЙ СТЕПИ (АЛТАЙСКИЙ КРАЙ, РОССИЯ) Биология

Текст научной статьи на тему «АЛЬГО-БАКТЕРИАЛЬНЫЕ СООБЩЕСТВА СОДОВЫХ ОЗEР КУЛУНДИНСКОЙ СТЕПИ (АЛТАЙСКИЙ КРАЙ, РОССИЯ)»

МИКРОБИОЛОГИЯ, 2015, том 84, № 1, с. 107-119

ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ

УДК 579.262:579.81:581.552

АЛЬГО-БАКТЕРИАЛЬНЫЕ СООБЩЕСТВА СОДОВЫХ ОЗEР КУЛУНДИНСКОЙ СТЕПИ (АЛТАЙСКИЙ КРАЙ, РОССИЯ)

© 2015 г. О. С. Самылина*, 1, Ф. В. Сапожников**, О. Ю. Гайнанова**, А. В. Рябова**, М. А. Никитин***, Д. Ю. Сорокин*

*Институт микробиологии им. С.Н. Виноградского Российской академии наук, Москва **Институт океанологии им П.П. Ширшова Российской академии наук, Москва ***НИИФХБ им. А.Н. Белозерского, Москва Поступила в редакцию 24.02.2014 г.

По материалам экспедиций ИНМИ РАН 2011 и 2012 гг. описана макроструктура и состав плавающих оксигенных фототрофных сообществ из содовых озер Кулундинской степи (Петуховского содового, Танатара VI и Горчины 3). Показано, что наиболее типичным является альго-бактериальное сообщество с зеленой нитчатой водорослью Ctenocladus circinnatus в качестве эдификатора. Доминирующими формами цианобактерий являются нитчатые Geitlerinema sp. и Nodosilinea sp. Альгологи-ческая компонента сообщества, помимо C. circinnatus, представлена одноклеточными зелеными водорослями Dunaliella viridis и cf. Chlorella minutissima, а также диатомовыми водорослями, видовой состав которых определен в исследуемых озерах впервые (Anomeoneis sphaerophora, Brachysira brebis-sonii, Brachysira zellensis, Mastogloiapusilla var. subcapitata, Nitzschia amphibia, Nitzschia communis, Nitzs-chia sp. 1). Показано, что значительное увеличение солености во всех озерах сопровождается изменением в макроструктуре и составе альго-бактериальных сообществ.

Ключевые слова: содовые озера, Кулундинская степь, альго-бактериальные сообщества, С1впос1айи$ агстпаШ, цианобактерии, диатомовые водоросли.

DOI: 10.7868/S0026365614060172

Содовые озера представляют собой пример природных местообитаний аталассофильного происхождения со стабильно экстремально высоким рН около 10. Озера Кулундинской степи расположены в криоаридном климате и являются единственным примером ультрагалинных содовых озер на территории России. Для них характерен переменный гидрологический режим с высокоамплитудными циклическими колебаниями температуры и концентрации рассола. При этом, по нашим наблюдениям, рассолы всегда остаются содовыми, но происходят изменения соотношения карбонат/бикарбонат ионов при незначительных колебаниях рН (от 9.7 до 10.5).

В этих озерах развиваются экстремофильные галоалкалофильные фототрофные сообщества. Оксигенными продуцентами в них являются цианобактерии и эукариотические водоросли, обеспечивающие высокую продуктивность озер этого типа, дающую начало развитой трофической цепочке живых существ, вплоть до птиц. Крайне живописное описание озер Танатар, сделанное

1 Автор для корреспонденции (e-mail: olga.samyli-na@gmail.com).

Б.Л. Исаченко, является прекрасной этому иллюстрацией: "Уже при первом знакомстве Танатары поражают богатством органической жизни, которая буквально кишит в рапе озер и следы которой видны везде на берегу: в рапе плавают мириады личинок Ephydra, а куколки ее покрывают все торчащие из воды предметы и массами лежат на дне озера. Громадные количества Artemia оживляют рапу. На берегу слоем в несколько сантиметров вышиной лежат выброшенные отложения куколок и личинок Ephydra и тела различных насекомых, среди которых значительную часть составляют крылатые муравьи. Всевозможные разжиревшие водяные птицы, начиная с чаек и кончая куликами или им подобными пернатыми, сидят на берегу, питаясь обильными количествами тех же муравьев и различными прямокрылыми" [1].

Работы по изучению содовых озер России проводятся с начала XX в. Классиками изучения микробного и альгологического разнообразия озер Кулундинской степи являются Б.Л. Исаченко [1] и Н.Н. Воронихин с сотрудниками [2—5]. В те годы были описаны доминирующие формы сине-зеленых и зеленых водорослей. Наличие диато-

Таблица 1. Исследованные озера и фототрофные сообщества в них (S — соленость)

Озеро Год pH S, г/л Щелочность, M Фототрофные сообщества

Na2CO3 общая (доминирующие организмы)

Петуховское содовое (52°6'16.48" N 79°9'54.06" E) 2011 10.18 100 0.96 1.11 Сплавина из C. circinnatus и цианобактерий Geitlerinema, Nodosilinea

2012 9.80 200 2.4 2.7

Горчина 3 (51°40'3.38" N 79°54'36.14" E ) 2011 10.30 90 0.80 1.00 Сплавина из C. circinnatus и цианобактерий Geitlerinema, Nodosilinea

2012 9.90 200 2.6 3.0

Танатар VI (51°36'55.69" N 79°49'17.55" E) 2011 10.04 160 1.30 1.70 Биопленки с доминированием Geitlerinema и Nodosilinea, а также присутствием C. circinnatus

2012 9.80 250 3.2 3.4 Цветение cf. Chlorella minutissima в планктоне

мовых водорослей также было отмечено, однако изучение их видового состава не проводилось.

Целью данной работы является описание состава оксигенных фототрофных сообществ содовых озер Кулундинской степи (по материалам экспедиций 2011—2012 гг.), а также изменений, произошедших в этих сообществах при увеличении солености.

МАТЕРИАЛЫ И МЕТОДЫ ИСЛЕДОВАНИЯ

Материалом для исследования послужили пробы плавающих фототрофных сообществ, собранные в ходе экспедиций ИНМИ РАН в начале июля 2011 и конце июня 2012 гг., из следующих содовых озер Кулундинской степи (табл. 1): Петуховское содовое (Ключевской р-н, Алтайский край), Гор-чина 3 и Танатар VI (Михайловский р-н, Алтайский край).

рН рассолов и соленость измеряли с помощью полевого потенциометра-кондуктометра ("WTW", Германия). При этом рН определяли в нативном рассоле и с разведением 1 : 5 и за истинное значение принималась средняя величина. Соленость также определяли в лаборатории весовым методом, и за истинное значение принимали среднюю величину, полученную двумя методами. Растворимую карбонатную щелочность рассолов определяли методом титрования 1 М HCl. Сначала 2_ _

титровали ион СО3 до HCO3 (Х) по фенолфталеину, затем — суммарный HCO_ по метилоранжу (X + Y). При этом суммарную величину карбонатной щелочности рассчитывали по формуле 2X + + (Y - X) = X + Y.

Суммарные спектры поглощения фототроф-ного сообщества из Петуховского содового озера снимали с использованием спектрофотометра Carry 100 Bio ("Varian", США). Экстракцию пигментов из фитобиомассы проводили 96% этанолом.

Выделение альгологически чистых культур ци-анобактерий и диатомовых водорослей осуществляли из накопительных культур, полученных при росте на карбонатных средах, имитирующих состав воды содовых озер.

Морфологию цианобактерий изучали в натив-ных препаратах ("раздавленная капля") под световым микроскопом Jenaval с фотоустановкой Zeiss Bundle Canon PS G9 (Германия). Фото сделаны с помощью программного обеспечения Axio-Vision Rel. 4.7.

Определение систематического положения доминирующих форм цианобактерий по морфологическим признакам проводили с помощью определителя [6].

Определение филогенетического положения доминирующих морфотипов цианобактерий было сделано для моноцианобактериальных культур P-1104 и P-1105, выделенных из Петуховского содового озера. Для определения частичной нуклео-тидной последовательности гена 16S рРНК ДНК выделяли CTAB-методом [7], амплифицировали с цианоспецифичными праймерами CYA359f и CYA781r [8] и секвенировали в ЦКП "Биоинженерия" РАН (г. Москва). Для нахождения близкородственных организмов использовали банк генов национального центра биологической информации (NCBI — http://www.ncbi.nlm.nih.gov) и программный пакет BLAST. Выравнивание последовательностей генов 16S рРНК производили с помощью программы BioEdit. Построение филогенетического дерева производили по последовательностям генов 16S рРНК длиной ок. 400 п.н. с помощью пакета программ TREECON [9] алгоритмом neigbour-joining с анализом 1000 альтернативных деревьев.

Таксономическую принадлежность диатомей, динофлагеллят и эвгленофитов определяли по живому и фиксированному этанолом материалу с использованием микроскопов Leica DMLS и Lei-

Рис. 1. Ctenocladus circinnatus Borzl из содовых озер Кулундинской степи: а — Петуховское содовое (2011 г.); б — Танатар VI (2011 г.). Масштаб линейки — 20 мкм.

ca DM 2500 с увеличением х1000. Виды диатомей определяли по морфологии и орнаментации панцирей на сыром материале.

Идентификация филогенетического положения была произведена для штамма Nitzschia communis T3-Nc11. Выделение ДНК производили с использованием набора Diatom DNAprep 100 ("Изоген"). Фрагмент гена 18S рРНК был амплифицирован с помощью стандартных прайме-ров Q5 (GTATCTGGTTGATCCTGCCAGT) и Q39 (TAATGATCCWTCYGCAGGTTCACCTAC) и набора реактивов для ПЦР Encyclo PCR kit ("Евро-ген"). Использовали следующую программу амплификации: 95°C — 3 мин; 38 циклов (93°C — 20 с, 56°C - 30 с, 72°C - 1.5 мин), 72°C - 5 мин. Продукты ПЦР были очищены препаративным электрофорезом в агарозном геле и секвениро-ваны на капиллярном секвенаторе в ЦКП "Геном" (г. Москва). Отдельные чтения были собраны в контиг в программе SeqMan. Для построения филогенетического дерева были использованы 13 последовательностей из баз данных, включая 8 определенных до вида представителей рода Nitzschia и 2 представителей других родов (Tryblionella и Bacillaria). Выравнивание нуклеотидных последовательностей генов 18S рРНК различных диатомей производили в программе MEGA 5.1 [10] при помощи алгоритма Muscle [11]. Филогенетические деревья были построены также в программе MEGA 5.1 алгоритмами Neighbor-Joining и Maximum Likelyhood с использованием гамма-распределения скоростей эволюции по сайтам и наличия инвариантных сайтов (GTR + I). Для оценки статистической достоверности деревьев было проведено 100 реплик бутстрэпа.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Альгологический состав фототрофных сообществ исследованных содовых озер был представлен эукариотическими и прокариотическими формами.

В Петуховском содовом озере и Горчине 3 развивались фототрофные сообщества с доминированием Ctenocladus circinnatus Borzi (рис. 1). Эта водоросль была описана в озерах Кулундинской степи Н.Н. Воронихиным и Т.Г. Поповой [3, 12] как новый род и вид Lochmiopsis sibirica Woronich. et Popova. Однако позднее была показана идентичность родов Lochmiopsis и Ctenocladus с сохранением более раннего родового и видового названия Cteno

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»