ГЕНЕТИКА, 2011, том 47, № 10, с. 1416-1419
КРАТКИЕ СООБЩЕНИЯ
УДК 577.21
An Improved Polymerase Chain Reaction Method for Genetic Testing of Spinocerebellar Ataxia Type 3 © 2011 W. P. Sun1, X. H. He1, L. Q. Yu2, D. P. Wang2, Zh. H. Qin1, Q. Fang2, J. Wrng1
department of Pharmacology and Laboratory of Aging and Nervous Diseases, Soochow University School of Medicine,
Suzhou 215123, China e-mail: wangjin@suda.edu.cn 2Department of Neurology, the First Affiliated Hospital of Soochow University, Suzhou 215006, China
e-mail: Fangqi_008@126.com Received March 01.2011
The development of a reliable PCR assay for genetic testing of spinocerebellar ataxia type 3. Touchdown PCR conditions were tested and different primer sets were evaluated with genomic DNA from blood sample of patients suffering from spinocerebellar ataxia type 3 (SCA3). An improved PCR assay was developed with a new set of primers and using the optimized touchdown PCR protocol. This new assay had been successfully employed in the screening of one identificated SCA3 family. Results from the present study document a simple and reliable PCR assay for genetic testing of SCA3. Strategies used in the present study may find applications in the optimization of PCR assay for triplet expansion with GC rich in the sequence context.
A number of neurological diseases are caused by the abnormal expansion of the CAG trinucleotide repeats in relevant genes [1]. Spinocerebellar ataxias (SCAs) are a group of chronic degenerative diseases of the central nervous system characterized by the progressive balance and coordination disorder [2]. The main affected regions are the spinal cord, cerebellum and brain stem, but abnormalities would also involve in other systems. Various types of SCAs overlapping one another in their clinical symptoms can only be carried out to their initial diagnosis, and confirmed diagnosis requires genetic analysis [3].
SCA3, known as Machado-Joseph disease (MJD) [4], is the most common SCA subtype among different races and origins in the world [5]. The related ATXN3 gene locates at 14q24.3-q32.2 encodes a gene product of protein ataxin-3 consisting of 960 amino acid residues [6]. The CAG repeat ofATXN3 is located in exon 4 and the normal allele carries 10 to 51 CAG repeat, while the mutant allele carries 55~87 repeats [7]. A PCR method with specific primers visualized by agarose gel electro-phoresis was previously reported to to detect the abnormal expansion of CAG repeats of ATXN3 of patient [4]. Although it worked, however, this reported assay was found to be inefficient and even yield false negatives when employed in our laboratory in screening SCA3 patients. Here we report an improved method with new designed primers and "Touchdown" PCR program, which achieved high efficiency and specificity of amplification of the CAG repeats in the ATXN3 gene. This new primer set and amplification method could provide reliable, quick and unambiguous genetic analysis in a clinical laboratory for the diagnosis of spinocerebellar ataxia type
The genomic DNA was extracted from the blood samples using the UNIQ-10 genomic extraction kit from
Sangon (Shanghai, China). Blood samples from clinically diagnosed SCA3 patients and their family members were collected in the First Affiliated Hospital ofSoochow University in Suzhou, China. This study was carried out following the Research Ethics Board approval of the First Affiliated Hospital of Soochow University.
Three primers were used, including one forward primer: SCA3F: 5' -CCAGTGACTACTTTGATTCG-3'; two reverse primers: SCA3R1: 5'-TGGCCTTTCA-CATGGATGTGAA-3', and SCA3R2: 5'-CATGAT-GAATGGTGAGCAGG-3'. SCA3F and SCA3R1 were reported previously. All primers are synthesized by the Sangon. PCR reaction was carried out in a 20 |l mixture, containing 80 ng of genomic DNA, 200 nM of forward and reverse primers, 200 |M each dNTP (dATP, dCTP, dGTP and dTTP), 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl and 1 unit of Taq DNA polymerase (Sangon, Shanghai). "Regular PCR" was carried out by 50 cycles of denaturing at 94°C for 30 seconds, annealing at 54°C for 30 seconds and extending at 72°C for 40 seconds. "Touchdown PCR" consisted ofphase I and phase II. In phase I, the PCR reaction was carried out by pre-denaturing at 94°C for 5 minutes followed by 36 cycles of denaturing at 94°C for 30 s, annealing temperature at initial 70°C with 1°C decrease every two cycles for 30 s and extending at 72°C for 40 s. In phase II: the PCR reaction was performed by 15 cycles ofdenaturing at 94°C for 30 s, annealing at 54°C for 30 s and extending at 72°C for 40 s. Four |l of PCR products were loaded and run on the 2% agarose gel stained with 0.5 |g/ml ethidium bromide. The amplified PCR products separated by the agarose gel were cut out and purified with AxyPreP™ DNA Gel Extraction Kit from AXYGEN (Union, USA). The purified
AN IMPROVED POLYMERASE CHAIN REACTION METHOD
1417
Primer Program M "
Primer setl
Touchdown PCR
3
4
bp 1500
800
500 -400 -300
200
Primer set2
Normal PCR
7
8
9
Fig. 1. Comparison of the CAG repeats amplification with different primers and PCR methods. Lanes 1, 4 and 7: normal control; lanes 2, 5 and 8: patient 1; lanes 3, 6 and 9: patient 2.
5
6
Fig. 2. Genetic analysis of a SCA3 patient family using primer set2 with "Touchdown" PCR program. Lanes 1—10 are the amplified products from members of the testing family, while the lane 10 is from the proband, lane 11 is the blank control, the lane 12 is from a normal sample and the lane 13 is positive control from a previously confirmed SCA3 patient not related to the testing family.
DNA fragments were directly sequenced (Invitrogen, Shanghai).
The efficiency and specificity between reported primer pair, primer setl (SCA3F and SCA3R1) and the new primer pair, primer set2 (SCA3F and SCA3R2) using different PCR program were evaluated by amplifying DNA samples from a normal control and two clinically diagnosed patients. Under the "regular PCR" condition, while primer set1 produced faint bands on agarose gel, primer set2 produced bright bands corresponding to normal and mutant allele of ATXN3 (Fig. 1, lanes 7, 8 and 9). PCR assay using the primer setl also amplified some non
specific products (Fig. 1, lanes 9). Those nonspecific bands sometimes caused incorrect call for mutant allele.
Two strategies were applied in the optimization of the PCR assay for the CAG repeat expansion in the present study: PCR primer selection and amplification protocol modification. The combinatory effect of a new PCR primer set 2 and the touchdown protocol significantly improved the assay's specificity and efficiency. These results were confirmed by DNA sequencing analysis (Fig. 2). Direct sequencing ofboth PCR products ofnor-mal control (Fig. 1, lane 4) and mutant allele of patient (Fig. 1, lane 5) showed the both allele of normal control
rEHETHKA TOM 47 № 10 2011
1418
SUN et al.
80 90 100 110 120 130
CAG AGAG CAGCAA AAG CAGCAAC AGCAGCAG CA GCAGCAGCAG CAGCAGCAGC AG CAG
140 150 160 170 180
CAGCA GCAGCAGCAG CAGCAGCAGC AGCAGC AGCA GCAGCAGCAG CAGCAGCAG
190 200 210 220 230 240
CAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
mtmmmmmmiMi
250 260 270 280 290 300
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA
Fig. 3. Sequencing data of a patient's DNA sample. There 66 CAG repeats found in the patient diagnosed by the new PCR assay presented in the present paper.
with 8 and 27 CAG repeats (data not shown) and the mutant allele with 66 CAG repeats (Fig. 3).
The newly developed PCR assay was used in the screening of the CAG repeats ofATXN3 gene in a family of a genetically diagnosed SCA3 patient (Fig. 3). Direct sequencing has showed that the patient carries an abnormal expansion with 66 CAG repeats of ATXN3. With the use of this newly developed PCR assay, four more family members were identified as they showed similar abnormal expansion of the CAG repeats (Fig. 2, lane 4, 7, 8 and 9) to the previously diagnosed patient (Fig. 2, lane 10). All the relevant bands were cut out for sequencing analysis (data not shown). The larger bands from lanes 4, 7, 8 and 9 had the same CAG repeats as the patient (Fig. 2, lane 10). The mutant allele carriers are all second generation of the patient. Due to their young age, they have not shown ataxia manifestation by the time of this genetic testing.
Genetic testing is mandatory in the confirmation of SCA3. The commonly used methods are direct sequencing, and PCR fragment sizing with capillary electro-
phoresis [8] or agarose gel. Albeit the resolution of agarose gel electrophoresis is relatively low, it is usually sensitive enough to distinguish PCR fragments with 10 nucleotides when 2—2.5% gel is used. The present study described a simple PCR method with agarose electro-phoresis in detecting abnormal CAG repeats of ATXN3. This new PCR assay is especially useful for the purpose of large scale screening. In case ofmarginal expansion ofthe CAG repeats with 3—5 triplets longer than normal, the suspected PCR amplified product could be better sized by running between known size of markers with specific number of CAG repeats, and direct sequencing could be an optional choice whenever needed in rare situations.
In summary, with the combination of optimized primer set used and modified amplification protocol of touchdown PCR, a simple, quick and reliable PCR assay for detecting abnormal CAG repeats in ATXN3 gene has been developed. This assay provides a genetic test for the diagnosis of spinocerebellar ataxia type 3. Furthermore, the significant improvement of the new PCR assay over previous reported assay suggests that the strategies used in
rEHETHKA tom 47 № 10 2011
AN IMPROVED POLYMERASE CHAIN REACTION METHOD
1419
this study may find applications in situations when GC rich fragments are difficult or failed in amplification.
ACKNOWLEDGMENT
This work was supported by Chinese National High Technology Research and Development
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.