научная статья по теме БЕЛОК PIWI КАК КОМПОНЕНТ ЯДРЫШКА У DROSOPHILA MELANOGASTER Биология

Текст научной статьи на тему «БЕЛОК PIWI КАК КОМПОНЕНТ ЯДРЫШКА У DROSOPHILA MELANOGASTER»

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ, 2015, том 49, № 1, с. 184-189

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ КЛЕТКИ

УДК 577.21

БЕЛОК PIWI КАК КОМПОНЕНТ ЯДРЫШКА У Drosophila melanogaster

© 2015 г. Е. А. Михалева, Е. Ю. Якушев, А. Д. Столяренко, М. С. Кленов,

Я. М. Розовский, В. А. Гвоздев*

Институт молекулярной генетики Российской академии наук, Москва, 123182 Поступила в редакцию 03.08.2014 г. Принята к печати 17.08.2014 г.

Эволюционно консервативный ядерный белок Piwi дрозофилы является представителем белков семейства Argonaute, связывающих короткие РНК. Piwi функционирует в сайленсинге транспозонов с участием piРНК в соматических и герминальных клетках гонад. Мы обнаружили, что в соматических и герминальных клетках яичника, а также в пересеваемой культуре соматических клеток яичника Piwi концентрируется в главном внутриядерном компартменте — ядрышке, участвующем не только в синтезе рибосомной РНК, но и в ответе клетки на разные стрессовые воздействия. Показано, что Piwi колока-лизуется с маркерными белками ядрышка — фибрилларином и Nopp140. МутацияpiwiNt, препятствующая транспорту Piwi в ядро и нарушающая репрессию транспозонов, приводит к 6-8-кратному увеличению экспрессии генов рРНК, оцениваемой по количеству транскриптов инсерций транспозонов в гены 28S рРНК. Обработка живых культивируемых соматических клеток яичника РНКазой удаляет Рiwi из ядрышка. Такой же эффект наблюдается при подавлении активности РНК-полимеразы I, ответственной за синтез рРНК, но не PНК-полимеразы II. Напротив, при тепловом шоке Piwi концентрируется в ядрышке и покидает область нуклеоплазмы. Эти результаты указывают на участие Piwi в модуляции активности PНК-полимеразы I и в ответе на стрессовые воздействия в ядрышке. Обсуждаются возможные неканонические функции Piwi, которые могут определяться не только его участием в сайленсинге транспозонов.

Ключевые слова: ядрышко, белок Piwi, рДНК, РНК-полимераза I, рРНК.

PIWI PROTEIN AS A NUCLEOLUS VISITOR IN Drosophila melanogaster, by E. A. Mikhaleva, E. Y. Yakushev, A. D. Stolyarenko, M. S. Klenov, Y. M. Rozovsky, V. A. Gvozdev* (Institute of Molecular Genetics, Russian Academy of Sciences, Moscow, 123182 Russia; *e-mail: gvozdev@img.ras.ru). The evolutionarily conserved nuclear Piwi protein of Drosophila melanogaster is a representative of the Argonaute small RNA binding protein family. Guided by small piRNAs, Piwi functions in transposon silencing in somatic and germ cells of the gonad. We found that in ovarian somatic and germ cells, as well as in the established ovarian somatic cell line, Piwi is concentrated predominantly in the nucleolus — the main nuclear compartment, participating not only in rRNA synthesis, but also in various cell stress responses. We demonstrated the colocalization of Piwi with nucleolar marker proteins — fibrillarin and Nopp140. A mutation preventing Piwi transport to the nucleus and disturbing transposon silencing (piwiNt) leads to 6-8-fold upregulation of rRNA genes expression, as evaluated by the level of transcripts of transposon insertions in 28S rRNA genes. RNase treatment of live cultured ovarian somatic cells depletes Piwi from the nucleolus. The same effect is observed upon inhibiting RNA polymerase I which transcribes rRNA, but not RNA polymerase II. In contrast, upon heat shock Piwi is concentrated in the nucleolus and is depleted from the nucleoplasm. These results implicate Piwi in RNA polymerase activity modulation and stress response in the nucleolus. We discuss possible noncanonical Piwi functions along with its canonical role in transposon silencing by piRNAs.

Keywords: nucleolus, Piwi protein, rDNA, RNA polymerase I, rRNA.

DOI: 10.7868/S0026898415010103

Белок Piwi дрозофилы является основателем подкласса белков Piwi, входящих в большое семейство Argonaute, которое у разных организмов объединяет белки, обеспечивающие функции ко-

* Эл. почта: gvozdev@img.ras.ru

ротких некодирующих РНК — микроРНК, коротких интерферирующих РНК ^РНК) и piРНК (РНК, связываемые белками подкласса Piwi) [1, 2]. Piwi у Б. melanogaster — это компонент системы

так называемого piPHK-сайленсинга, направленного, в основном, на репрессию транспозонов как в клетках зародышевого пути, так и в окружающих их соматических клетках [3]. Короткие piPHK (25—35 н.) образуются в результате про-цессинга транскриптов кластеров, содержащих фрагменты транспозонов [4, 5]. С помощью белка Piwi и короткой piPHK достигается узнавание в ядре комплементарных последовательностей транскрипта транспозона, что приводит к гетерохро-матинизации и транскрипционному сайленсингу транспозона [6—8]. Однако детали участия Piwi в этом процессе остаются невыясненными. Ортоло-ги белка Piwi у млекопитающих также участвуют в репрессии транспозонов, сопровождающейся метилированием ДНК [9], а нарушение экспрессии этих ортологов характерно для онкотранс-формации [10, 11]. Известно, что у дрозофилы источником piPHK могут быть отдельные клеточные мРНК, селектируемые системой piPHK-за-висимого сайленсинга. В этом случае piPHK может, по-видимому, подобно микроРНК участвовать в регуляции кодирующих белки генов [12], при этом не только транспозоны будут мишенями комплексов piPHK-Piwi. Например, у морского моллюска Aply-sia ортолог Piwi участвует в сайленсинге гена, кодирующего транскрипционный фактор нервной системы [13]. Насколько нам известно, особенности внутриядерной локализации белка Piwi у D. melanogaster или его ортологов у других объектов не были охарактеризованы ранее. В настоящей работе мы обнаружили преимущественную локализацию Piwi в ядрышке, ответственном помимо биогенеза рибосом за ряд других важных регуля-торных функций, связанных, например, с регуляцией клеточного цикла или с ответом на стрессовые воздействия [14, 15]. Отметим, что ряд белков семейства Argonaute в клетках человека связывает короткие РНК, соответствующие нуклеотидным последовательностям рРНК, причем получены указания на функциональную значимость этих комплексов [16]. В последнее время проявляется интерес к исследованию функциональной роли фрагментов РНК с известной общеклеточной функцией (мРНК, тРНК и рРНК), которые могут представлять собой не случайные продукты деградации этих транскриптов [17, 18], а предшественники функциональных коротких РНК. Обнаружение Piwi в составе ядрышка открывает путь к выявлению новых неканонических функций этого белка.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Линии дрозофил. При выявлении в норме ядерного белка Piwi с помощью иммуноокрашивания использовали яичники гетерозиготных особей генотипов piwiNt/+ и piwi2/+ [19]. Для оценки влияния гена piwiNt, кодирующего нетранспортируе-мый в ядро белок Piwi, на экспрессию генов

рРНК методом OT-ПЦР сравнивали количество транскриптов инсерций R1 и R2 в яичниках мутантов piwiNt/piwi2 и в смеси гетерозигот (норма) piwiNt/+ и piwi2/+.

Иммуноокрашивание. Фиксирование и окрашивание эмбрионов проводили согласно протоколу: http://fruitfly4.aecom.yu.edu/labmanual/12.html.

Яичники и культивируемые соматические клетки фиксировали в фосфатно-солевом буфере с 3.7%-ным формальдегидом, промывали этим же буфером с 0.3% Тритона Х-100 и 0.1% Tween 20, замораживали при —20°C, оттаивали и инкубировали в течение 1 ч в этом же буфере с 0.3%-ным Тритоном Х-100, 0.1%-ным Tween 20 и 0.3%-ной козьей натальной сывороткой, инкубировали в течение ночи на холоду со специфическими антителами, с последующей отмывкой буфером с 0.3%-ным Тритоном Х-100 и 0.1%-ным Tween 20, а затем с вторичными антителами, конъюгирован-ными с флуоресцентными красителями (использовали красители Alexa 488, Alexa 546 и Alexa 633 для антител мыши, кролика и морской свинки в разных комбинациях, "Invitrogen"), с последующей отмывкой буфером с 0.3%-ным Тритоном Х-100 и 0.1%-ным Tween 20. Используемые антитела: к Piwi — поликлональные кролика (1 : 500, от G. Hannon) или моноклональные мышиные (сыворотка, 1 : 5, от М. Siomi); к фибрилларину — поликлональные кролика (1 : 1000, "Abcam"); к Nopp140 — поликлональные морской свинки (1 : 300, от P. DiMario); к лалину — поликлональные кролика (1 : 500 от P.A. Fisher).

Культуру пересеваемых стволовых соматических клеток яичника OSC поддерживали, как описано ранее [20], в среде M3 c добавлением 10%-ной фетальной сыворотки и 10%-ного экстракта мух. Для приготовления экстракта 1 г мух (3—7 дней после вылета) гомогенизировали в 6.8 мл среды М3, центрифугировали в течение 15 мин при 1500 g, надосадок прогревали (10 мин, 60°C), осадок удаляли центрифугированием.

Обратная транскрипция с последующей поли-меразной цепной реакцией (ОТ-ПЦР). Суммарную РНК из яичников мух (0—7 дней после вылета) выделяли с помощью реагента Trizol ("Invitrogen"), осаждали 70%-ным этанолом при —20°C. ДНК удаляли осаждением при -20°C с 3.3 М LiCl и последующей обработкой ДНКазой I ("Ambion") в течение 1 ч при 37°C. Обратную транскрипцию проводили в трех повторностях для равного количества РНК из нормальных (смесь особей piwiNt/+ и piwi2/+) и мутантных (piwiNt/piwi2) яичников с использованием олиго^Т-праймеров ("Силекс") и обратной транскриптазы SuperScriptII ("Invitrogen") по методике производителя. Количество транскриптов инсерций R1 и R2 оценивали с помощью ПЦР в реальном времени с ДНК-поли-меразой Hot Start ("SibEnzyme") и красителем

186

МИХАЛЕВА и др.

SYBR Green I на приборе ДТ-96 ("ДНК-технология"), результаты нормировали на количество мРНК гена Adh. Использовали праймеры: R1A1 forward AATTCCCGAGCTGTGCTAGA, R1A1 reverse GTCTCAAGGCACCTTTCAGC [21]; R2 element s1 TGCTCCCGAAACAACAAACCAC, R2 element as1 AACAATGACCACGCAGCCTC; Adh_RI_s GCCTGCGTACATAGCCGAGAT Adh_RI_as GCT-CCGTTAGTTGTTGGTTTCC.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

Piwi локализуется в ядрышках в клетках эмбрионов, в соматических и герминальных клетках яичника

С помощью иммуноокрашивания нами была обнаружена колокализация Piwi и фибрилларина, маркера ядрышка, в ядрах клеток раннего эмбриона. Такой результат получен при использовании двух различных антител к Piwi. На рис. 1а показана колокализация этих белков в синхронно делящихся ядрах синцития на стадии ранней бластодермы, когда еще не сформи

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»