научная статья по теме БИОХИМИЧЕСКАЯ И СТРУКТУРНАЯ ХАРАКТЕРИСТИКА F^-АГФ-СИНТАЗЫ STRЕРTОMУСЕS FRАDIАЕ АТСС 19609 Химия

Текст научной статьи на тему «БИОХИМИЧЕСКАЯ И СТРУКТУРНАЯ ХАРАКТЕРИСТИКА F^-АГФ-СИНТАЗЫ STRЕРTОMУСЕS FRАDIАЕ АТСС 19609»

БИОХИМИЯ, 2015, том 80, вып. 3, с. 358 - 373

УДК 577.23.013

БИОХИМИЧЕСКАЯ И СТРУКТУРНАЯ ХАРАКТЕРИСТИКА F^-АТФ-СИНТАЗЫ Streptomyces fradiae АТСС 19609*

© 2015 М.Г. Алексеева1, Т.А. Мирончева1, Д.А. Мавлетова1, С.М. Елизаров2, Н.В.Захаревич1, В.Н. Даниленко1**

1 Институт общей генетики им. Н.И. Вавилова РАН, 119991 Москва, ул. Губкина, 3; факс: +7(499)132-8962, электронная почта: valerid@rutenia.ru

2 Институт биохимии им. А.Н. Баха РАН, 119071 Москва, Ленинский просп., 33, корп. 2; факс: +7(495)954-2732

Поступила в редакцию 22.07.14 После доработки 27.10.14

Исследовано фосфорилирование белков в препаратах суббактериальных инвертированных мембранных везикул Streptomyces fradiae АТСС 19609, содержащих мембраносвязанные РоРгАТФ-синтазы. Методом двумерного электрофореза с последующим масс-спектрометрическим анализом впервые установлено, что в составе синтазного комплекса осуществляется фосфорилирование ß- и b-субъединиц; идентифицировано 20 белков с установленными функциями. Осуществлено клонирование генов F^-АТФ-синтазы в Escherichia coli и получены рекомбинантные белки всех восьми субъединиц: а, ß, у, 8, е, а, b и с. С использованием суммарного препарата серин-треониновых протеинкиназ (СТПК) впервые показано фосфорилирование рекомбинантных y-, ß-, а- и е-субъединиц. В обоих типах экспериментов наблюдалось фосфорилирование ß-субъединицы FoFj-АТФ-синтазы. Отличия в фосфорилировании белков во фракции мембранных везикул и рекомбинантных белков могут быть связаны с присутствием разных СТПК в используемых препаратах, а также зависеть от этапов сборки и функционирования FoFrАТФ-синтазы. Установлена структура оперона, содержащая все субъединицы и регуляторный белок I. Исследовано филогенетическое сходство субъединиц FoFJ-АТФ-синтазы Streptomyces fradiae АТСС 19609 с субъединицами различных групп сапрофитных и патогенных бактерий (в т.ч. Mycobacterium tuberculosis). Полученные результаты могут указывать на значительную роль серин-треониновых протеинкиназ в функционировании FoFJ-АТФ-синтазы. В практическом плане данные могут быть использованы для конструирования оригинальной тест-системы и создания новых биомишень-направленных лекарств против патогенных бактерий.

КЛЮЧЕВЫЕ СЛОВА: FoFJ-АТФ-синтаза, АТФаза, серин-треониновые протеинкиназы, инвертированные мембранные везикулы, Streptomycetes.

Актуальной задачей современной биологии и медицины является поиск новых средств для лечения различных заболеваний человека. Многие исследования, направленные на создание инновационных лекарственных препаратов, основываются на данных о молекулярных мишенях лекарств нового поколения. Одной из популярных в настоящее время биомишеней является РоРгАТФ-синтаза — универсальная молеку-

Принятые сокращения: СТПК — серин-треонино-вые протеинкиназы, ФМСФ — фенилметилсульфонил-фторид, ТХУ — трихлоруксусная кислота, ДТТ — дитиотре-итол, KN-62 — ингибитор Са2+-зависимых протеинкиназ, Бис-I — бисиндолилмалеимид-I, п.н. — пары нуклеотидов, а.о. — аминокислотные основания.

* Приложение к статье опубликовано на сайте «Biochemistry» (Moscow), Vol. 80, issue 3, 2015.

** Адресат для корреспонденции.

лярная машина, осуществляющая синтез (и в определенных условиях гидролиз) АТФ в митохондриях эукариот, хлоропластах растений и бактериях. РоБ1-АТФ-синтаза представляет собой многосубъединичный фермент, состоящий из растворимой Б1-части, катализирующей синтез АТФ из АДФ и неорганического фосфата за счет ротационного движения центрального стержня молекулы, и связанной с ней Бо-части, погруженной в мембрану молекулы [1, 2]. Б1-часть РоБ1-АТФ-синтазы бактерий включает пять субъединиц: а, в, у, 8 и е. Р0-часть синтазы содержит три субъединицы: а, Ь и с. Этот комплекс присутствует в митохондриях эукариот и клеточной стенке бактерий [3—5].

РоРгАТФ-синтаза вовлечена в поддержание клеточного рН, а также регуляцию эндоцитоза, пролиферации и апоптоза [6, 7]. В последние го-

ды разрабатываются лекарственные препараты, способные воздействовать на функционирование F^-АТФ-синтазы различных организмов, в первую очередь человека и патогенных бактерий [8, 9]. Ингибирование активности F^-АТФ-синтазы может осуществляться не только путем взаимодействия с ее собственными субъединицами, но и с сопряженными биомишенями в суббактериальных инвертированных мембранных везикулах. Был разработан новый препарат, ориентированный на F^-АТФ-синтазу Micobacterium tuberculosis: отобрано соединение бедакуилин, которое ингибирует F^-АТФ-синтазу микобактерий и показывает высокую и избирательную активность in vitro и in vivo [10, 11]. F^-АТФ-синтазы актинобактерий при большом структурном сходстве отличает от фермента других бактерий зависимость активности от ионов Ca2+ [12, 13] и чувствительность к антибиотику олигомицину А [14—17]. Основной биомишенью действия является с-субъединица F^-АТФ-синтазы и ее гомолог у эукариотичес-ких клеток [18]. Антибиотики семейства олиго-мицинов и другие ингибиторы F^-АТФ-син-тазы человека и бактерий рассматриваются как потенциальные лекарственные препараты [19], однако их продвижение в качестве фармацевтических препаратов ограничивается высокой токсичностью. Впервые российскими учеными получены более 20 полусинтетических производных олигомицина А, обладающих более низкой токсичностью [20, 21].

В литературе имеются единичные указания на фосфорилирование 8- и с-субъединиц в митохондриях эукариот [22, 23], р-субъединицы в митохондриях скелетной мышцы человека [24] и хлоропластах [25], р-субъединицы у M. tuberculosis [26]. Полагают, что фосфорилирование компонентов комплекса может влиять на проницаемость мембран митохондрий (субъединица с), структуру комплекса F^-АТФ-синтазы (субъединица Р) и может иметь PDGF-зависи-мый характер (субъединица 8). Ранее нами был установлен феномен повышения устойчивости клеток бактерий и F^-АТФ-синтазы в составе мембранных везикул к олигомицину А в результате появления в клетках нечувствительной к олигомицину A формы F^-комплекса и определена чувствительность к ингибиторам (олиго-мицину A и др.) F^-АТФ-синтазы трех штаммов стрептомицетов in vivo и in vitro. Впервые было показано, что во фракции мембранных везикул актинобактерии Streptomyces fradiae АТСС 19609 содержатся по крайней мере две активные серин-треониновые протеинкиназы (СТПК), способные фосфорилировать мембранные белки, и их активность регулируется ионами Са2+

[17]. Построена структура F^-АТФ-синтазного оперона и осуществлено филогенетическое сравнение субъединиц кодируемых им белков с аналогичными белками различных групп сапрофитных и патогенных бактерий.

Основной целью работы является изучение фосфорилирования белков F^-АТФ-синтаз-ного комплекса S. fradiae АТСС 19609 с использованием двух подходов: 1) в составе мембранных везикул, включающих мембраносвязанные СТПК, и 2) путем фосфорилирования рекомби-нантных белков всех восьми субъединиц, полученных в Escherichia coli, суммарным препаратом СТПК S. fradiae АТСС 19609.

МЕТОДЫ ИССЛЕДОВАНИЯ

Бактериальные штаммы, векторы, среды и условия культивирования. В работе использован штамм S. fradiae АТСС 19609 (геном штамма секвенирован в лаборатории генетики микроорганизмов ИОГен РАН, последовательность генома депонирована в GenBank под номером JNAD00000000) и штаммы E. coli DH5a (F-, Ф80 AlacZAM15 A(lacZYA-argF) U169) фирмы «Promega» (США) [27] и BL21(DE3) (F- dcm ompT hsdS(rB-mB-) gal X (DE3)), плазмида pET32a фирмы «Novagen» (США) [28]. Для выращивания штамма S. fradiae АТСС 19609 использовали жидкую среду YEME с 25% сахарозы (m/V) [29] при 28° в течение 24 ч (позднелогарифмический рост), мицелий собирали в течение 30 мин центрифугированием при 3000 g. Для выращивания клеток E. coli использовали среду Лурия (L-бульон). Твердые среды содержали 2,0% агара (m/V) [30]. Для обеспечения селективного роста плазми-досодержащих клеток добавляли ампициллин (100 мкг/мл).

Манипуляции с ДНК. Тотальную ДНК штамма S. fradiae АТСС 19609 выделяли методом, изложенным в руководствах Кизер с соавт. [29]. Выделение плазмидной ДНК, приготовление компетентной культуры E. coli, трансформацию и анализ рекомбинантных плазмид проводили с использованием стандартных методов [30]. ПЦР с тотальной ДНК штамма S. fradiae АТСС 19609 проводили с использованием набора РСК-100 («Dialat Ltd.», Россия) на приборе PTC-0150 («MJ Research, Inc.», США). Для амплификации фрагментов ДНК всех субъединиц было сконструировано 10 олигонуклеотидов, гомологичных фланкирующим областям а-, c-, b-, 8-, a-, y-, ß- и s-субъединиц F^-АТФ-синтаз, находящихся в базе данных NCBI (http://www.ncbi.nlm. nih.gov/) штаммов S. coelicolor, S. lividans и S. aver-mitilis с использованием программы NCBI/Primer-

BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast/). Олигонуклеотиды для клонирования были сконструированы на основании секвенирования нуклеотидных последовательностей амплифи-цированных субъединиц (табл. 1). Амплифици-рованные субъединицы клонировали в экспрес-сионный вектор рЕТ32а по сайтам эндонуклеаз

рестрикции EcoRI и HindIII. Скрининг полученных рекомбинантных клонов проводили с помощью ПЦР с использованием стандартных праймеров S • Tag и T7term.

Изучение экспрессии генов F^-АТФ-синтазы в Е. coli. Экспрессию генов субъединиц FoF1-АТФ-синтазы штамма S. fradiae АТСС 19609

Таблица 1. Олигонуклеотиды, используемые в работе

Олигонуклеотид Структура олигонуклеотида (5'-3')* Рестриктаза

ATPAN CCATGCGCCACGCTGAAGG -

ATPAC TGCTCAGTGGTGCTCGGC -

ATPCN CGGTGGCCAACCCCCAC -

ATPCC AGGCCGATGACGAGCTCGGGGA -

ATPBN GGCGGCCGGCCTGATCCGC -

ATPBC GGCCAGCTCGTCGGCGAGC -

ATPIN ATGCCGTCCAATGACGTCCG -

ATPIC CTCCTTCAGCGTGGCGCATG -

Del(+) CGGCAGCGCGAGGAGATCAT -

Del(-) GACCTCCTCGCGCGAGGCCG -

Ap(+) TAGCCTGGAGTCGGGACTC -

Alp(-) GTGACGGATCGGATGCGACG -

Gam(+) GCACCACCGGCAAGATGGAC -

Gam(-) GGAGATGGTGCGGACCAGGC -

Beta(+) AATCAGCGAGATCGTCGGTGGC -

Beta(-) GACGTGCAGCTCAGCAGCCA -

Eps(+) GGCGTTCTTCATGTGCGGTGGC -

Eps(-) CCGCACACAGTCAGAGCGAG -

ATPFAN ATCCGAATTCGTGAGTGCTGACCCGACAACG EcoRI

ATPFAC CCGCAAGCTTGTGGTGCTCTGCGAGAGCG HindIII

ATPFCN ATCCGAATTCATGTCCCAGACCCTTGCTGC EcoRI

ATPFCC CCGCAAGCTTA

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Химия»