BMO-MIR-9A DOWN REGULATES THE EXPRESSION OF BM-ASE GENE IN VITRO
© 2013 Fei Song a, Yong Huang a>c, Xin Wang a, Shunming Tang a, Xingjia Shen a> b> #
a Jiangsu University of Science and Technology, Zhenjiang Jiangsu 212018, China b The Key Laboratory of Silkworm and Mulberry Genetic Improvement, Ministry of Agriculture, Sericultural Research Institute, Chinese Academy of Agricultural Sciences, Zhenjiang Jiangsu 212018, China c Animal Science and Technology College, He Nan University of Science and Technology, Luoyang City, 471003, Henan Province, PR China Received June 25, 2012; in final form July 10, 2012
Abstract—MicroRNAs (miRNAs) are a class of non-protein coding small RNAs of 18—24 nucleotides in length that regulate expression of genes at post-transcriptional levels and play multiple roles in biological processes. Bm-ase plays an important role in the course of nerve development of the silkworm, Bombyx mori. Bmo-miR-9a is a conservative miRNA. By using target prediction software RNA22 and RNAhybrid, we found a target site of Bmo-miR-9a in the 3'UTR of Bm-ase gene. To verify the regulation function of Bmo-miR-9a on the expression of Bm-ase gene, a Bmo-miR-9a over-expressing vector and Bm-ase 3'UTR fused firefly luciferase gene reporter plasmid were constructed, respectively. Then they were used to co-transfect the BmN cells. The result showed that luciferase activity in the co-transfected cells was suppressed compared with the control. A similar result was obtained when BmN cells were co-transfected with artificial synthetic Bmo-miR-9a mimics and Bm-ase 3'UTR fused luciferase reporter plasmid. These results suggest that Bmo-miR-9a can down regulate the expression of Bm-ase gene.
Keywords: Bombyx mori, MicroRNA, Bmo-miR-9a, Bm-ase, Post-transcriptional regulation DOI: 10.7868/S013234231302005X
INTRODUCTION
MicroRNAs (miRNAs) are a class of non-protein coding small RNAs of 18—24 nucleotides in length that regulate the expression of target genes by binding on complementary sequences of target mRNAs [1—3]. The previous studies indicate that miRNAs are involved in lots of biological events, including development, hematopoietic lineage differentiation, organ formation, proliferation, apoptosis, host-viral interactions and tumorogenesis [4, 5]. Therefore, the research on miRNAs has become one of the hot fields of life sciences. So far, large numbers of miRNAs have been identified, but functions of few of them are well known, especially in the silkworm (Bombyx mori) miRNAs. It is crucial to identify target genes of miRNAs for understanding their biological functions and potential molecular mechanisms. Based on computational prediction approaches, the target gene of miRNA-13, CG10222 was firstly verified with the luciferase reporter system in Drosophila melanogaster [6]. Now this luciferase reporter system is proven to be quite helpful to validate the target genes of miRNAs in vitro [7]. In our laboratory, expression vectors of miRNA-9a and miR-NA-2b of the silkworm were constructed, and down
# Corresponding author. Fax: +86-511-85622507; E-mail address: shenxj63@yahoo.com.cn
regulation of the expression of P25 gene by miRNA-2b was detected [8, 9].
The achaete-scute complex (AS-C) is a group of transcriptional factors involved in the formation of bristles in Drosophila melanogaster. In the silkworm, Bombyx mori there are four achaete-scute homologs (ASH), Bm-ASH1, Bm-ASH2, Bm-ASH3 and Bm-ase [10]. These genes encode proteins containing bHLH domain, and genes of this family are involved in the regulation of the development of central nervous system and peripheral nervous system, myogenesis, blood corpuscles formation, sex determination, midgut development in metazoans [10]. Bm-ase is mainly expressed in the neural precursor cells, and it is a homolog of asense, which is essential for the development of neural precursor cells in Drosophila melanogaster [11]. According to the protein structure analysis, Bm-ase shares more than 70% identities with other insect Asense proteins within the bHLH region [10, 12]. During the embryonic development Bm-ase reveals two expression peaks, one on 3 d and the other on 6 d, and these two periods may be accompanied by two climaxes of nervous system development [10]. Through the target prediction software, Bm-ase was predicted to be one of the target genes of Bmo-miR-9a and experimental verification was conducted.
Result predicted by RNA22:
From offset 86 to 108_| Folding energy = — 33.799999 kcal/mol_
5' ^ target ^ 3' -linker- 5' ^ miscroRNA ^ 3'
CATACAGCTGTGTGTACCAAGGT GCGGGACGC UCUUUGGUUAUCUAGCUGUAUGA
AGUAUGUCGAUCUAU-UGGUUUCU
Result predicted by RNAhybrid:
mfe: —29.1 kcal/mol position 85
target 5' 3'
GUAUGUCGAU UAU UGGUUUC
Fig. 1. Results predicted by miRNA target prediction software.
RESULTS
Prediction of Silkworm miRNAs Targeting 3'UTR of Bm-ase Gene
By using target prediction software RNAhybrid and RNA22, considering the scores and the perfect complementarities between the seed region of the miRNA (a 7-nucleotide sequence from base 2 to 8 in the 5' end of the miRNAs) and the target site, we found Bm-ase might be one of the target genes of Bmo-miR-9a (Fig. 1).
Construction of expression vectors
To confirm the expression vectors constructed, pGL3[FH-luc-ase3'UTR-SV40] and p[FH-EGFP-miR9a] were double digested with Xbal-Fsel and BamHI-Hindlll respectively, and a Bm-ase 3'UTR fragment and a miR-9a fragment was identified, respectively (Fig. 2), implying that the expression vectors contain the interested gene fragments.
Regulation of Bm-ase gene expression by Bmo-miR-9a
In the transfection experiments p[FH-EGFP] (an EGFP gene was cloned into pCDNA3.0 plasmid and controlled by BmFib-H promoter) was served as a negative control for p[FH-EGFP-miR9a]. The pRL-CMV plasmid served as an internal control. Two independent experiments were carried out, and three replicates were set for each experiment. The results showed that at 48 h post infection the expression of pGL3[FH-luc-ase3'UTR-SV40] was down regulated to 87.4% by Bmo-miR-9a, compared to the negative
controls (Fig. 3), suggesting that Bmo-miR-9a can suppress the expression of Bm-ase gene.
Regulation of Bm-ase gene expression by artificial Bmo-miR-9a mimics
The pGL3[FH-luc-SV40] and the "Bmo-miR-9a mimics negative control" served as negative controls for pGL3[FH-luc-ase3'UTR-SV40] and the artificial Bmo-miR-9a mimics, respectively. The pRL-CMV served as an internal control. Firefly luciferase activity values, normalized by renilla luciferase activity, were
M1 M2 12 3 4
bp
2000 —
750 — 500 —
250 —
Fig. 2. Identification of the expression vectors pGL3[FH-luc-ase3'UTR-SV40] and p[FH-EGFP-miR9a]. M1 -DL2000 DNA Marker; M2 - X-HindIII Marker; 1, 2 -pGL3[FH-luc-ase3'UTR-SV40] digested by XbaI and FseI; 3, 4 - p [FH-EGFP-miR9a] digested by BamHI and HindIII.
5 г
pGL3[FH-luc-ase3'UTR-SV40] pGL3[FH-luc-ase3'UTR-SV40] + + pRL-CML + p[FH-EGFP] pRL-CMV + p[FH-EGFP-miR9a]
pared to the relative luciferase activities of pGL3[FH-luc-SV40]. The effect of Bmo-miR-9a mimics on Bm-ase gene expression showed the same trend as the Bmo-miR-9a expression vector did (Fig. 4). The relative luciferase activities of cells co-transfected with pGL3[FH-luc-ase3'UTR-SV40] and Bmo-miR-9a mimics were suppressed down about 17.7% compared to those of cells co-transfected with pGL3[FH-luc-ase3'UTR-SV40] and mimics negative control (P < 0.05).
From the above results, a conclusion can be drawn that Bmo-miR-9a targets Bm-ase gene by interacting with its 3'UTR, i.e. Bm-ase is one of the target genes of Bmo-miR-9a, and Bmo-miR-9a can down regulate the expression of Bm-ase gene.
Fig. 3. Bmo-miR-9a expression vector inhibits the Bm-ase gene expression in BmN cells. Cells were co-transfected with p[FH-EGFP] or p[FH-EGFP-miR9a], firefly luciferase reporter containing Bm-ase 3'UTR (indicated as pGL3[FH-luc-ase3'UTR-SV40] on the X axis), and Renilla luciferase expression construct (as an internal control). Luciferase activity was assayed 48 h after trans-fection. Firefly luciferase values, normalized for Renilla luciferase, are presented. The data represent the mean values ± SD of 3 independent experiments done in duplicates.
25
£ 20
15
о
e lat
el
РЙ
10
□ mimics Negative Control ■ miR9a mimics
JL
pGL3[FH-luc-SV40] pGL3[FH-luc-ase3'UTR-SV40]
Fig. 4. Analysis of luciferase activity. Cells were co-trans-fected with mimics Negative Control or miR9a mimics, firefly luciferase reporter containing either Bm-ase 3'UTR or nothing (indicated as pGL3[FH-luc-ase3'UTR-SV40] or pGL3[FH-luc-SV40] on the X axis), and Renilla lu-ciferase expression construct (as an internal control). Lu-ciferase activity was assayed 48 h after transfection. Firefly luciferase values, normalized for Renilla luciferase, are presented. The data represent the mean values ± SD of 3 independent experiments done in duplicates.
presented as relative luciferase activity (firefly luciferase activity/renilla luciferase activity). The results revealed the relative luciferase activity of pGL3[FH-luc-ase3'UTR-SV40], in which Bm-ase 3'UTR was linked to the 3' end of luciferase, were suppressed com-
DISCUSSION
The miR-9a belongs to the mir-9 family. It is one of the miRNAs that is highly expressed in the mammalian brain and is 100% conservative at the nucleotide sequence from fly to human, suggesting that miR-9a plays an important role in brain development [13—15]. Drosophila melanogaster miR-9a regulates the development of sensory organ precursors via suppressing the expression of sens gene [16]. Drosophila mir-9a regulates wing development via ne-tuning of expression of dLMO, which is a transcription cofactor directly inhibiting the activity of Apterous [17]. All of these findings implied that a close relationship exists between miR-9a and nervous system development. In our study, Bmo-miR-9a down regulated the expression of Bm-ase which involved in neural development in the
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.