ГЕНЕТИКА, 2014, том 50, № 11, с. 1394-1397
КРАТКИЕ СООБЩЕНИЯ
УДК 575.17:595.36
CHARACTERIZATION OF NEW MICROSATELLITES SELECTED FROM EST RESOURCES OF CHINESE MITTEN CRAB, Eriocheir sinensis
© 2014 E. M. Guo1,2, D. H. Wu2,3, F. Tan2, L. S. Song2, S. S. Cai4, Z. X. Cui2
1 Marine Science and Engineering College, Qingdao Agriculture University, Qingdao 266109, China
e-mail: emguo2013@126.com
2 EMBL, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
e-mail: zhxcui@ms.qdio.ac.cn
3 Faculty of Life Science and Biotechnology, Ningbo University, Ningbo 315211, China
4 Graduate Department of Ocean University of Qingdao, Qingdao 266003, China
Received May 8, 2014
Sixteen new microsatellites were identified by screening 7533 expressed sequence tags of Chinese mitten crab, Eriocheir sinensis from GenBank data we published. They were polymorphic with the PIC value ranged from 0.349 to 0.957, the number of alleles ranged from 22 to 48, and the observed and expected heterozygosities ranged from 0.375 to 1.000 and 0.366 to 0.983, respectively. Five loci could be applicable to genetic diversity and population structure of E. sinensis.
DOI: 10.7868/S0016675814110046
The Chinese mitten crab (Eriocheir sinensis) is an important aquaculture species largely exploited in China because of its flesh quality and delicious taste. As a consequence, large-scale mitten crab aquaculture center has formed in China, and it brings great destroy to the original germplasm resources of mitten crab. On the other hand, although Chinese mitten crab European population does not originate from a single pan-mictic population [1], it is still regarded as invading species in some European and American countries, competing endogenous species and destroying local ecology [2]. Therefore, it is important and necessary to characterize the population structure of Chinese mitten crab and identify their kinships of different water systems for management, conservation, breeding and commercial production.
Microsatellites have been widely utilized in fishery species [3—7]. For E. sinensis, with conducting a partial or enriched genomic library, Hänfling and Weet-man discovered 12 polymorphic microsatellite loci [1]; Chang et al. [8] developed 18 microsatellite markers; Zhu et al. [9] identified five novel microsatellites; Mao et al. [10] isolated 12 microsatellite loci. However it is not enough for study on the genetic diversity of species. Here, the aim is to develop more suitable microsatellite markers to investigate the genetic variation and population structure of the Chinese mitten crab.
In this research, a total of 7533 E. sinensis expressed sequence tag (EST) with average length of 425 bp ranging from 100 to 695 bp were collected from our published paper [11] and screened for di-, tri-, tetra-, pen-ta-, hexa-, seven and eight nucleotide repeat using the modified sputnik II program (http://wheat.pw.us-
da.gov/ITMI/EST-SSR/LaRota/) [12]. The criteria used for searching microsatellite repeat were 10 repeats for dinucleotide, 8 for trinucleotide, 6 for tetra-nucleotide, 5 for penta- and hexa-nucleotide, 3 for seven and eight nucleotide.
We designed 57 primer pairs out of674 loci with the software package of Premier Primer version 5.0. They were synthesized and tested on genomic DNA from 24 individuals (Panjin, Liaoning, China) to analyze polymorphism and levels of heterozygosity and to determine optimal polymerase chain reaction (PCR) amplification. PCR amplification of microsatellites was performed in 10 |L reaction volumes containing 1 |L (~20 ng) of template DNA, 250 |M of each dNTP, 2mM MgCl2, 1x buffer, 0.5 U of r-Taq polymerase (TaKaRa), and 0.2 |M of each forward and reverse primer. The thermal cycling profile was initial denaturation at 94°C for 2 min, then 30 cycles at 94°C for 30 s, annealing temperature (Table 1) for 30 s and 72°C for 90 s, with an extension of 5 min at 72°C in the final cycle. PCR products were ran on 8% polyacryla-mide gels and visualized by Ethidium bromide staining. Descriptive statistics and null allele frequency were performed using CERVUS 2.0 [13]. Tests for Hardy—Weinberg equilibria (HWE) and linkage dise-quilibria were performed using GENEPOP on the web [14]. And the polymorphism information content (PIC) was computed according to Nei and Li [15] as follows:
n
PICi = 1 - £ xj
J = i
Table 1. Characterization of 18 polymorphic microsatellite loci for E. sinensis
Locus Repeat sequence Primer sequences (5— 3') T °c Range in size, bp No. alleles Ho PIC HWE (Pvalue) GenBank Accession no.
NE11 (ACT)22 F: TGCTTATCTGCCTTGCTG R ACATTTGACGGTGGGACT 55 218- -286 47 0.830 0.870 0.848 0.274 Contig 1439
NE20 (CTA)18-(ACT)s F: GCCGCTGCTTCCATCTGA R TCGGTCCGGGTCGGTATA 60 147- -206 46 0.935 0.927 0.911 0.000* Contigl404
NE25 (CA)17GA(CA)3 F: AGGAGGTGCGTAAGAGTGA R TTTCCTTCCATCCTGAGTC 57 180- -230 46 0.957 0.875 0.852 0.000* gi|188547658
NE26 (CA)1S F: ACGGGAAATGGAACAGAT R TCCTTCCATCCTGAGTCC 55 106- -165 47 0.979 0.917 0.901 0.000* gi|221551900
NE27 (AG)33 F: ACGGGAAATGGAACAGAT R TCCTTCCATCCTGAGTCC 55 116- -147 42 1.000 0.903 0.883 0.000* gi|221551900
NE30 (GT)17 F: ACAGTTTGTAAGGTTCAGCAC R GCCACCCTAACTCAATCAG 57 162- -212 47 0.936 0.904 0.885 0.000* gi|188548724
NE33 (CCA)6 F: GGTTGTAAATGGCTCGGTT R ATGCCTCTTTTCCTTGGTC 55 92- 126 48 0.375 0.366 0.349 0.468 gi|221554409
NE36 (CCA)n F: ATGTGGACTGCGGGAGA R GTGGTGGTAGGTTCGTCTGT 59 162- -212 24 0.917 0.857 0.821 0.004* gi|188548163
NE38 (CA)14 F: ACCACCATTACCTCCTACC R CTCAGCAGTGCCCTTTAT 57 128- -170 48 0.979 0.782 0.735 0.000* gi|188549688
NE44 (CA)n-(AC)10 F: TTGGCTGCACCAAGTGAG R ATCGTCGATATGTGGGTATTT 56 238- -309 47 0.617 0.854 0.828 0.000* gi|221554115
NE45 (CATT)7 F: CGGCGAGACTCACGAACT R CGAGGGTGAAGAGGCATT 59 217- -264 45 0.867 0.861 0.835 0.000* gi|221554310
NE48 (CA)10-(CA)5 F: AAAGGTCAGTTAATTTCTTGAT R TCTAGTGAAATGACATATTGGT 52 123- -175 45 0.644 0.754 0.718 0.001* gi|221552 662
NE49 (AC)25 F: AGACCGCTGTTATGCTCCT R ATGGGAATGAAGGTTATGTATG 56 175- -250 46 0.957 0.936 0.922 0.000* gi|221552838
A769 (TG)14 F: AGGCTGCTCATTTGTCT R CCTACCTTACCCTACCCTAC 57 135 -197 22 0.772 0.952 0.945 0.0748 gi|89 078311
A685 (GT)23 F: TTTCACATCCTCCACAGACA R TGAACTTGACGAGGGAGG 53 125- -196 23 0.913 0.957 0.957 0.0714 gi|270127783
A926 (CT)54 F: CCTCCTCCAAATAAGCAAC R AGTCGCCAATGCTTCTCT 58 250- -283 30 0.696 0.983 0.957 0.0467 gi90903191
Notes: Ta, annealing temperature; Hq, observed heterozygosity; i/g, expected heterozygosity; PIC, polymorphism information content; *, significant deviation from HWE after Bon-ferroni correction.
vo
Lfi
1396 GUO et al.
Table 2. Type and distribution of microsatellite sequences in EST data of E. sinensis
Type of microsatellite locus Repeat sequence No. of alleles (Total 674) Maximum number of repeat No. of various types of locus Percentage of the total loci, %
Dinucleotide AC/GT 437 73 567 84.12
AG/CT 107 14
AT/AT 23 3
Trinucleotide AAG/CTT 3 2 92 13.65
AAT/ATT 32 8
ACC/GGT 14 10
ACG/CTG 1 1
ACT/ATG 16 6
AGC/CGT 1 1
AGG/CCT 4 3
AGT/ATC 21 7
Tetranucleotide AAAG/CTTT 2 1 11 1.63
AAGG/CCTT 2 1
AAGT/ATTC 3 1
ACAT/ATGT 2 1
ACTC/AGTG 1 1
AGTC/AGTC 1 1
Hexanucleotide ACTCGG/AGCCTG 2 2 2 0.296
Seven nucleotide AAGCCTT/AATTCGG 1 1 1 0.148
Eight nucleotide AACATAAG/ATTCTTGT 1 1 1 0.148
Where x is the frequency of the ith allele of the jth marker.
Six hundreds and seventeen (8.2%) ESTs containing simple sequence repeat (SSR) were identified. The percentage of SSR uncovered was greater than that reported for barley [16] and Pacific oyster [17] where only 7.5 and 1.3% of the ESTs were found to contain SSRs respectively. This suggested that E. sinensis ESTs were indeed a valuable source of markers. There were 50 EST sequences containing two or more microsatellite loci. Totally 674 microsatellite loci were detected. 35 loci were compound formation. The dinucleotide unit was dominant (567 repeats, 84.12%). Then followed by tri- (92, 13.65%), tetra- (11, 1.63%), hexa-(2, 0.296%), seven (1, 0.148%) and eight (1, 0.148%) nucleotide unit, respectively. In these microsatellite sequences, AC/GT and AAT/ATT were the most common di- and trinucleotide sequence. They accounted for 70.18% (473) and 4.75% (32) of the total microsatellites (Table 2). Among the dimeric repeats the motif, AC/GT was the most frequent. On the contrary, AC/GT was the least often in oyster (3.6% of all SSRs) [18]. AT microsatellites were detected rarely in this study (4% of the total microsatellites). It was in accordance with reports from maize and rice [19, 20]. While the most abundant trimetic motifs AAT/ATT in this study appeared rarely in rice. This probably im-
plied the difference in protein synthesis between these species [19].
Sixteen polymorphic microsatellite loci for the Chinese mitten crab were developed (Table 1). The value of PIC ranged from 0.349 to 0.957, the number of alleles ranged from 22 to 48, the observed and expected heterozygosities ranged from 0.375 to 1.000 and 0.366 to 0.983, respectively. And 5 loci were in Hardy-Weinberg equilibria (HWE). Compared to other SSR data from mitten crab [8—10], EST had more variable expected heterozygosity values and the higher number of alleles, which suggested that microsatellite loci from EST were more reliable to analyze population structure.
ACKNOWLEDGMENTS
We thank Xiaodong Li for collecting the samples. This research was supported by Chinese National '863' Project under Grant No. 2006AA10A406 and the National Natural Science Foundation of China 40976088 to Dr. Zhaoxia Cui.
REFERENCES
1. Hänfling, B., Weetman, D., Characterization of microsatellite loci for the Chinese mitten crab, Eriocheir sinensis, Mol. Ecol. Notes, 2003, vol. 3, no. 1, pp. 15—17.
rEHETHKA TOM 50 № 11 2014
CHARACTERIZATION OF NEW MICROSATELLITES
1397
2. Holdich, D., Pockl, M., Biological Invaders in Inland Waters: Profiles, Distribution, and Threats, Francesca, G.
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.