ГЕНЕТИКА ЖИВОТНЫХ =
УДК 575.17
DEVELOPMENT OF A MICROSATELLITE SET FOR PATERNITY ASSIGNMENT OF CAPTIVE RHESUS MACAQUES (Macaca mulatta) FROM ANHUI PROVINCE, CHINA
© 2013 Y. R. Xua, J. H. Lia' ь, y. Zhua, B. H. Suna
aSchool of Resource and Environmental Engineering, Anhui University, Hefei, 230601 China
e-mail: xyr7330904@126.com bCollege of Life Science, Anhui Normal University, Wuhu, 241000 China e-mail: jhli@ahu.edu.cn Received October 23, 2012
Microsatellites are playing an important role in paternity assignment of animals. Given the cost and effort, it would be optimal to develop a minimal microsatellite marker set for paternity testing. This study was the first to assess paternity in a captive colony of rhesus macaques (Macaca mulatta) from the Chinese province of Anhui using 10 polymorphic microsatellites. Results indicated that if at least 6 loci were genotyped, the probability of paternity assignment success was nearly 100%. Our results provide a panel of 6 markers that is effective for assessing paternity of subspecies M. m. siamica of Anhui origin.
DOI: 10.7868/S001667581307014X
Rhesus macaques (Macaca mulatta) due to their anatomically and physiologically similarities to humans are widely used as excellent experimental animal models. They have been extensively used in medical and biological research, such as reproductive biology, behavior, developmental psychology, aging, immunology, and infectious disease [1—6]. However, captive colonies could be prone to inbreeding because of isolation and a small number of founder individuals. Studies have demonstrated inbred primates were at greater risk for morbidity and mortality, and had lower reproductive performance [7—9]. Therefore, genetic management which includes individual identification, population genetic analyses and pedigree construction is crucial for primate breeding centers. Paternity assignment based on microsatellites could be used to validate the accuracy of pedigrees which are often based on housing or demographic records solely. In addition, it can help maintain the viability of the colony and characterize the genetic background of the animals. Thus, more well-characterized animals will be produced for experimental requirements [10] and the effectiveness of experiments will be increased by knowing the genetic background of individuals used in medical and physiological studies.
Microsatellite markers or short tandem repeats (STRs) are short DNA segments that accumulate high levels of variation within populations or species [11, 12]. They are a class of codominant DNA markers that have a simple and stable inheritance pattern. Compared with other molecular markers, they have many advantages such as extensive dispersion around the genome, high polymorphism, ability absolutely
size alleles, rapid and convenient detection, and uses a small DNA sample. Therefore, use of microsatellite genotyping for maternity or paternity testing is a routine procedure for captive or wild animal populations, and they have been widely utilized in human and animal parentage testing and individual identification [13-19].
There also have been many studies identifying microsatellite polymorphism in rhesus macaques [3, 2023], which indicated that microsatellites have great potential in the genetic management of primate colonies. However, no one marker is guaranteed to be highly polymorphic in all rhesus macaque populations. Some loci show differently informative among macaques of different regional origin including different subspecies. For example, allelic diversity and frequency for some loci were different between Indian-and Chinese-origin rhesus macaques [24]. Previous studies using direct sequencing of microsatellite could probably explain the variation between individuals and species [25-27].
Macaca mulatta siamica is an important subspecies of rhesus macaques in China [28]. Rhesus of this subspecies from Anhui province have not been utilized as experimental animals in large scale, and no previous research about paternity testing based on microsatellite markers have been conducted. Here we were the first to assess paternity of M. m. siamica from Anhui province using microsatellites with high genetic diversity reported by previous studies. Given the cost and effort required to characterize genotypes for all loci studied, it would be optimal to know the minimum number of loci sufficient to meet selected criteria for
Table 1. Characteristics of 10 microsatellite loci used in this study
Locus Genebank accession Primer sequence Repeat motif References
D1S207 Z16601 CACTTCTCCTTGAATCGCTT GCAAGTCCTGTTCCAAGTCT (CA)n [22]
D18S537 G07990 TCCATCTATCTTTGATGTATCTATG AGTTAGCAGACTATGTTAATCAGGA (TATG)n [23]
D17S791 Z16689 GTTTTCTCCAGTTATTCCCC AGAGTTCTTCATTCCTTTCC (CA)n [23]
D7S503 Z16870 ACTTGGAGTAATGGGAGCAG GTCCCTGAAAACCTTTAATCAG (CA)n [38]
D5S820 G08470 ATTGCATGGCAACTCTTCTC GTTCTTCAGGGAAACAGAACC (GATA)n [42]
D5S1457 G08431 TAGGTTCTGGGCATGTCTGT TGCTTGGCACACTTCAGG (GATA)n [40]
D6S311 Z17200 ATGTCCTCATTGGTGTTGTG GATTCAGAGCCCAGGAAGAT (CA)n [23]
D14S306 G09055 AAAGCTACATCCAAATTAGGTAGG TGACAAAGAAACTAAAATGTCCC (GATA)n [23]
D11S925 Z17002 AGAACCAAGGTCGTAAGTCCTG TTAGACCATTATGGGGGCAA (CA)n [23]
D13S159 Z16870 GCTGTGACTTTTAGGCCAAA TGTGATGTCTACAACTCCAGG (CA)n [41]
paternity testing. Hence, our primary objective was to evaluate the effectiveness of a set with minimum microsatellite markers for paternity resolution from a larger panel of microsatellites. This could provide a useful tool for paternity testing of large number of rhesus macaque individuals in captive colonies of this origin.
MATERIALS AND METHODS
Samples and DNA extraction. Genomic DNA was extracted from 300 ^L EDTA anti-coagulated blood samples which were collected from 48 captive rhesus macaques (bred in different cages) including 6 adult males, 7 adult females and 35 offspring in Anhui Laboratory Center ofRhesus Monkey, China. Bloods were washed with 1 mL of 0.9% NaCl, 1 mM EDTA solution to lyse red blood cells and remove hemoglobin. Centrifugation was performed at 6000 rpm for 8 min, and then the supernatant was discarded. Precipitate was suspended in 500 ^L CTAB solution (2% CTAB, 1 M NaCl, 1 M Tris-Cl, 0.5 M EDTA, pH 8.0) and digested with proteinase-K (5 mg/mL) at 65°C for 2— 3 h. Genomic DNA was extracted by phenol/chloroform and examined on 1.0% agarose/TBE gel. The DNA samples were stored at —20°C and used as template PCR reactions.
Microsatellite amplification and genotyping. Ten microsatellite markers were selected from the previous studies of rhesus macaques (Table 1). Forward primers were fluorescently labeled with TAMRA, FAM, or
HEX. A sample of 48 rhesus macaques was screened for each of the loci. PCR reactions were conducted in a 25 |L volume containing 1 |L of DNA solution, 2 |L of 2.5 mM dNTPs, 2.5 |L of10x EasyTaq buffer (20 mM Tris-HCl, pH 8.0, 200 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 0.6 |L of each forward and reverse primer (10 |M), 0.35 |L of 5 U/|L EasyTaq DNA polymerase). PCR amplification was performed on thermal cycler (Bio-Rad S1000, USA) using with the following conditions: initial denatur-ation for 5 min at 94°C, followed by 30 cycles of 30 s denaturation at 94°C, annealing at 50—60°C for 30 s, extension at 72°C for 1 min, then a final extension at 72°C for 7 min. All ten STR were amplified in a sin-gleplex reactions pooled only at the step of electrophoresis.
The PCR products were visualized on ABI 3730XL and compared using GS500_1 size standard. DNA fragments of different lengths were read with software GeneMapper 4.0 (Applied Biosystems, Foster City, CA, USA).
Paternity analysis. CERVUS program version 3.0 [29] was used to assess the effectiveness of the microsatellite marker set and likelihood paternity analysis, which uses a categorical allocation approach that assigns offspring categorically to non-excluded fathers based on maximum likelihood. CERVUS simulation parameters included: Number of offspring = 10000, Number of candidate fathers = 3, Prop. Sample = 1, Proportion of loci typed depends on allele frequency
Assignment rate, %
123456789 10 Number of microsatellite loci
Relationships between number of microsatellite loci and assignment rate of progeny to correct sire. The x axis showed the number of loci used for each CERVUS simulation. The more loci were utilized the rate of paternity assignment was higher.
analysis, Rate of typing error = 0.01, Relaxed confidence level = 80%, Strict confidence level = 95%.
Data analysis. Genetic parameters in terms of number of alleles (K), observed heterozygosity (Ho), expected heterozygosity (He), polymophism information content (PIC), exclusion probabilities (PE) for each locus when the genotypes of both parents were known, and combined exclusion probabilities (PEc) for a given set of loci were estimated using CERVUS version 3.0 software. In addition, deviations from Har-dy—Weinberg equilibrium (HWE) and Linkage disequilibrium were tested using GENEPOP version 4.0 [30].
RESULTS
Variation of microsatellites
A total of 48 individuals were genetically typed at the ten microsatellite loci (Table 2). Each locus was found to be highly polymorphic (Table 3). The number of alleles varied between 5 and 16 with a mean of 11.8 alleles per locus. The observed heterozygosity (Ho) and expected heterozygosity (He) ranged from 0.4681 to 0.9500 (the average value was 0.6918) and from 0.5116 to 0.9171 (the average value was 0.7940), respectively. PIC values ranged from 0.4613 to 0.8989 with a mean value 0.7638 and PE value ranged from 0.1325 to 0.6825. The combined exclusion probabilities (PEc) of 10 microsatellite loci were 0.9988. Three loci (D6S311, D18S537, and D5S1457) were found to deviate from Hardy—Weinberg equilibrium, but no linkage disequilibrium was detected between loci pairs. Table 3 indicated that PIC value had a positive correlation with PE value. Therefore, the microsatellite loci with higher polymorphism have
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.