научная статья по теме DEVELOPMENT OF PCR-BASED SNP MARKER OF RICE WAXY GENEWITH CONFRONTING TWO-PAIR PRIMERS Биология

Текст научной статьи на тему «DEVELOPMENT OF PCR-BASED SNP MARKER OF RICE WAXY GENEWITH CONFRONTING TWO-PAIR PRIMERS»

ГЕНЕТИКА, 2015, том 51, № 7, с. 787-791

ГЕНЕТИКА РАСТЕНИЙ

УДК 575.113.1:633.258

DEVELOPMENT OF PCR-BASED SNP MARKER OF RICE Waxy GENE WITH CONFRONTING TWO-PAIR PRIMERS © 2015 H. Caia, D. Xua, L. Zhoua, J. Chenga, Z. Zhang4, J. Wua, A. Youa

aHubei Key Laboratory of Food Crop Germplasm and Genetic Improvement, Food Crops Institute, Hubei Academy of Agricultural Sciences, Wuhan 430064, China e-mail: aq_you@163.com

bState Key Laboratory of Hybrid Rice, College of Life Sciences, Wuhan University, Wuhan 430072, China

Received July 30, 2014

Rice amylose content (AC) is a key determinant for grain end-use quality attributes. The base substitution (G ^ T) at +1 loci of the first intron (In1) of Waxy (Wx), a major gene controlling AC in rice, results in decreased AC. A new SNP typing method of Wx In1 based on polymerase chain reaction with confronting two-pair primers (PCR-CTPP) was reported here: first its practicability was confirmed by 23 varieties with known SNP and AC; and then the segregation ratio at target SNP loci were checked and it fitted well for 1 : 2 : 1 single gene segregation; at last SNP typing and AC assay with 150 mini core collections (MCC) in China showed that average AC of 53 G type varieties (22.5%) was significantly higher than that of 97 T type varieties (13.7%) (p < 0.01) and the target SNP loci explained 77.8% AC variation. So this method could be used to estimate AC of rice variety roughly or in marker-assisted breeding, that is, using variety with known and desired AC as Wx allele donor parent and aided with crossbreed, backcross and marker-assisted selection (MAS) reported here, rice breeders could improve AC of varieties with comprehensively excellent performance to meet special end-products.

DOI: 10.7868/S001667581506003X

Rice is a most important staple food because more than half of the population in the world take it as a source of daily carbon intake. Starch comprises approximately 90% of the rice grain and AC is the key determinant of rice end-use quality attributes, such as low AC is suitable for making baby food and high AC for making gourmet powder, rice-noodle, brew beer or biodegradable material [1]. Consequently, rice breeders develop varieties maintaining desired AC and comprehensively excellent performance to meet special end-products. Studies showed that, rice Wx gene, encoding a granule-bound starch synthase (GBSS), was a major gene controlling AC in endosperm starch [2, 3]. There were two Wx alleles (Wxa and Wxb ) in rice which belong to indica and japonica rice varieties respectively. Compared with Wxa, a single nucleotide substitution (G ^ T) at + 1 position of the In1 consensus cleavage site in Wxb led to inefficient splicing In1 from pre-mRNA, and there was about 10% of mature Wx transcript and Wx protein which eventually resulted in lower AC in Wxb [4—8]. So varieties with different AC could be achieved by Wx In1 SNP selection in rice breeding programme [9].

There are multiple SNP typing methods so far including sequencing, SNaPshot, mass-spectrography, SNP chip, high resolution melting, etc. [10—13], but these methods are technology-complex, time-consuming and expensive for large-scale screening in breeding. Derived cleaved amplified polymorphic se-

quence (dCAPS) is a relatively simple method used for SNP detection [14], but it requires time-consuming post-amplification enzymatic cleavage. PCR-CTPP is another method for SNP typing which needs four primers with single PCR reaction, and SNP type is determined by different product length, so it's the best choice for high-throuthput SNP typing [15]. In this study, SNP typing marker of rice Wx In1 was developed based on PCR-CTPP with some modifications and its applications were confirmed.

MATERIALS AND METHODS

Primer design and PCRs. Primers were designed according to the Wx sequence of Zhenshan 97 (an elite female parent of many hybrids in China with G base at target SNP, NCBI Genbank accession no. GQ151066) and Minghui 63 (a restorer line with T base at target SNP, NCBI Genbank accession no. GQ151064). As for G-type allele-specific primer (Fig. 1), firstly, GR was fixed at upstream of target SNP loci (G base) meanwhile with it as 3'-terminal using manual search mode of Primer Premier 5.0, and then with edit primer function to analyse its melting temperature (Tm) until it was about 60°C to fix 5'-terminal loci; because there was no limitation for the location of GF, so a primer at upstream of GR with Tm about 50°C and matching GR with highest score was selected using automatic search mode. T-type allele-specific primers TF and TR were developed as the same. According to PCR-CTPP

788

CAI et al.

G-type allele

T-type allele

-387 bp-

GF

207 bp

GR

GF

CAC

-GTT-♦

SNP

I

—T -

A

TR

TF

235 bp

TR

Fig. 1. Schematic representation of SNP typing method for rice Wx In1 based on PCR with confronting two-pair primers (PCR-CTPP). Target SNP loci is G/T substitution, mismatch between 3' terminal base and template ensured allele specificity. To strengthen specificity of inner primer GR, another mismatch (C ^ T) was introduced at —3' loci of 3' terminal. There is a 207 bp product for G-type allele, a 235 bp product for T-type allele and a 387 bp product in common with both allele.

theory, the mismatch at 3'-terminal between GR and T-type template (C/T) or TF and G-type template (A/G) would hold back amplification when the mixture of four primers amplified with G-type or T-type template separately, but our results showed that one mismatch could not hold back amplification of G-type allele-specific primer with T-type template, so another mismatch (C/T) was introduced at —3' loci of GR to strengthen its specificity. Details of the primers were listed in table.

PCR was performed in 20 ^L reactions containing 0.2 mM of each four primer, 200 mM of dNTP mixture, 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2 and 0.2 ^L of Taq polymerase. PCR amplification consisted of a denaturing step of 94°C/5 min, followed by 35 cycles of 94°C for 45 s, 58°C for 45 s (annealing), and 72°C for 45 s, ending with an extension step of 72°C for 5 min. Amplifications were separated by 2% agarose gel.

Plant materials examined. In this study three groups of rice materials were used according to different purposes: 1) 23 reported cultivars with known AC and SNP at Wx In1 were detected to validate the accuracy of the marker in this study; 2) 100 F2 individuals derived from a cross between Zhenshan 97 and Minghui 63 were used to verify segregation ratio at Wx In1 SNP loci;

3) 150 mini core collections (MCC) which retained 76.97% of the phenotypic variation of 4310 Chinese accessions of Oryza sativa L. [16] were checked for AC and Wx In1 SNP type to clarify the correlation between them.

DNA extraction and AC measurement. Total genom-ic DNA was extracted from fresh rice leaves (mixture of three individuals for each variety) using CTAB method [17] and AC was determined with procedures described by Tan et al. [18] including boiling, cooling, ether-extraction and titration. Milled rice were ground into powder with a Udy Cyclone Sample Mill (Udy Corp., Fort Collins, CO, USA) in duplicate and ab-sorbance was measured by Cary100 (Varian corp., Palo Alto, USA) spectrophotometer.

RESULTS

Development and validation SNP typing marker for rice Wx In1

Confronting two-pair primers were designed based on PCR-CTPP method. Because G-type allele-spe-cific primers amplified the same products with G-type or T-type template, another mismatch was introduced at —3' locus for GR to strengthen the specificity (Fig. 1). 23 backbone parents in China with known AC and SNP were used to testify its accuracy and results showed that the G-type varieties with higher AC produced a 207 bp band, T-type with lower AC produced a 235 bp band, and both ofthem had an 387 bp product in common (Fig. 2,a), which were in line with expectations. So SNP typing of rice Wx In1 can be achieved easily with the method in current study.

Segregation ratio of the SNP loci in the F2population

To test the segregation ratio of the target locus, 100 F2 individuals derived from the cross between Zhens-han 97 (target SNP is G base) and Minghui 63 (target SNP is T base) were screened and results showed that the segregation ratio was 29GG : 48GT : 23TT, which fitted well to the ratio 1 : 2 : 1 expected for single men-

delian locus segregation (x2 = 0.88 < x0.O5 = 5.99). So it's a co-dominant marker that can distinguish ho-mozygosis and heterozygosis individuals at Wx In1 loci (Fig. 2,b).

Sequence details of SNP typing primer for rice Wx In1

Primer names Primer sequences (5' ^ 3') Tm value Product type Product length

GF TACAAATAGCCACCCACA 49.4°C

TR GATCAGCCTAACCAAACA 48°C GF-TR (in common) 387 bp

GR GGGAAACAAAGAATTATAAACATATATGTACAC 60.5°C GF-GR (G-type) 207 bp

TF CATCAGGAAGAACATCTGCAAGT 60.8°C TF-TR (T-type) 235 bp

"_", mismatch base.

DEVELOPMENT OF PCR-BASED SNP MARKER

789

a bpM 1 2 3 4 5 6 7 8 9 10111213 141516171819 20 21 22 23

40

300

100

Amylose content, %:

(NfN(NMr)(N(N(N(NNM

b

MP1P2 1 2 3 4 5 6 7 8 9 101112 13 1415 16 171819 20 21

200 150

100

G T GTG T GTGTGTGTGT TGTGTT GT T G G

GGT T GT

Fig. 2. Gel image showing the difTerent genotypes of the rice Wx gene. M: DL500 DNA marker. a, 23 varieties with known SNP and AC as template. Lanes 1—11 are 11 G-type variety: Teqing, Jin 23B, Ejin B, Zhong 9B, Yangdao 4, Yuetai B, R287, HR141, HR820, Jinke 1B, R8006; lanes 12-23 are 12 T-type variety: 9311, Mianhui 725, Fuhui 838, HD9802S, Ezao 18, Minghui 63, Huanghuazan, Yue 4A, Y58S, Guangzan 63S, Zaoyou 143, YuetaiA. Amylose content of each variety was presented under corresponding lane. b, some F2 individuals segregating at Wx In1 loci as template. P1 and P2 are parents variety Zhenshan 97 and Minghui 63, which belong to G-type and T-type, respectively; lanes 1-21 are parts of F2 plants and the SNP type of each plant was presented under corresponding lane.

Correlation a

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»