научная статья по теме DEVELOPMENT OF POLYMORPHIC MICROSATELLITES FOR MELOIDOGYNE INCOGNITA, THROUGH SCREENING PREDICTED MICROSATELLITE LOCI BASED ON GENOME SEQUENCE Биология

Текст научной статьи на тему «DEVELOPMENT OF POLYMORPHIC MICROSATELLITES FOR MELOIDOGYNE INCOGNITA, THROUGH SCREENING PREDICTED MICROSATELLITE LOCI BASED ON GENOME SEQUENCE»

ГЕНЕТИКА, 2015, том 51, № 1, с. 128-132

КРАТКИЕ СООБЩЕНИЯ

УДК 575:595.132

DEVELOPMENT OF POLYMORPHIC MICROSATELLITES FOR Meloidogyne incognita, THROUGH SCREENING PREDICTED MICROSATELLITE LOCI BASED ON GENOME SEQUENCE

© 2015 G. Wang*, E. F. Li*, Z. C. Mao, and B. Y. Xie

Key Laboratory of Horticultural Crops Genetic Improvement, Ministry of Agriculture, Institute of Vegetables and Flowers,

Chinese Academy of Agricultural Sciences, Beijing 100081, China e-mail: lrfcaas@gmail.com, gang0805@126.com Received June 23, 2014

Microsatellites are extensively distributed in the eukaryotic genome, and they are widely used for their high polymorphism and accessibility. The microsatellites in M. incognita, a worldwide agriculture pest, are inadequate for diversity research. A repertoire of 1620 microsatellites appeared appropriate to design primer as markers were identified based on the M. incognita genome. 120 loci were chosen as candidate, from which 88 microsatellites were characterized. Finally, we found 13 polymorphic microsatellites with 2 to 23 alleles in a survey of three nematode populations in China, while other positive loci were monomorphic. These new molecular markers afford to genetic diversity analysis in M. incognita population of poorly investigation. Furthermore, the predicted microsatellites have potential values for other plant parasitic nematodes.

DOI: 10.7868/S0016675815010130

Root-knot nematodes of the genus Meloidogyne, causing considerable yield loss every year, are major agriculture pests of a wide host range and M. incognita is possibly the most damaging plant pathogen [1]. Their worldwide distribution raises question about its route of introduction and the genetic structure of this species. Meanwhile, the genetic variability of pathogen is necessary for developing effective control practices through breeding programs [2].

Microsatellite is one of the most popular and versatile genetic markers at the individual level in biology because of their abundance, high polymorphism, high transferability, and co-dominant inherited character [3]. However, the useful marker has been poorly investigated in Meloidogyne for the reason of insufficient template amount for multiple analysis, which is difficult to gain from such small organisms.

Recently, 15 microsatellites of M. incognita have been described from an enriched genomic library, three of which exhibited a significant level of intrapopulation polymorphism with 3 to 7 alleles detected [4]. The most conventional approach, screening enriched genomic library for microsatellite motifs clone, is so challenging, time-consuming and low-efficiency that optimal results can't be produced. In addition to insufficient of 3 polymorphic loci for us to analysis genetic structure in various organisms, the loci couldn't be successfully amplified from the Chinese populations that we have researched. The completion of genome sequence has provided a high-throughput approach for identifying microsatellite loci [5]. 4880 mi-

* The authors contributed equally to this work.

crosatellite loci were detected according to the genome of M. incognita previously, but no information of availability and polymorphism about these loci was provided [6].

Based on the genomic resource, we reported here PCR (Polymerase Chain Reaction) primers to amplify microsatellite loci in M. incognita and then investigated the polymorphism of some loci with three populations from China. In order to ensure sufficient templates for amplifying candidate loci, a whole-genome amplification (WGA) step was employed during the screening procedure.

We got the M. incognita genome sequences from the website at http://www.inra.fr/meloidogyne incognita. Microsatellites mining was carried out using software Msatfinder —2.0.9 with the motif criteria that di-, tri-, tetra-, penta- and hexa-nucleotide microsatellites repeat at least 8, 5, 5, 5 and 5 times, respectively. Furthermore, Primer 3 software, which is implemented in Msatfinder, was used to design the primer pairs for microsatellite bearing sequences with the default settings.

Three nematode populations were respectively collected from vegetable growing areas in Hainan (N = 49), Henan (N = 44) and Shandong (N = 48) provinces in China. We isolated the egg masses from vegetable roots and each nematode came from different egg masses. The species identification was based on morphology and confirmed using a multiplex PCR which could detect M. incognita, M. enterolobii, and M. javanica simultaneously [7]. Candidate microsatellite loci were amplified from two nematodes in Shandong population for further sequencing. 30 individuals from Hain-

Table 1. Characteristics of the 13 polymorphic microsatellite loci

Locus accession No. Repeat motif Forward primer Reverse primer Ta (°C) Size rang (bp) Alleles

M01 (TTTA)41 F: CGGAATTTTCCATTCTCCTC 56 156 23

JX853736 R: TGTGCGCGATTTATCAAAAG

M02 (AAAT)28 F: CCGGATCAGACAACCTTATTG 56 40 10

JX853737 R: GACGAAAGCCGTCTAGTTCG

M05 (TATT)15 F: ATAACCGCCGCCTTTTATTC 56 40 8

JX853739 R: CGCCTCCTCAATTTGTCTTC

M06 (TAAA)13 F: CGGTAGGTACATTGTGGTTGC 56 28 6

JX853738 R: TAGGGGAAGCCGTTTAGCTT

M07 (CA)25 F: GAGATATCACGGATATCAAGGG 56 22 10

KJ145403 R: ACACGAAAGCTTGGAGTGTAG

M09 (CT)21 F: GGCACCGAGACACTTTTGA 56 6 4

KJ145404 R: GAGGCGAAACGTTTGAGAAT

M10 (TA)21 F: CTATTACCGACGCCCAAAAA 56 24 10

JX853740 R: AAAAGACTCTCGTCATCCAAAAA

M16 (TG)19 F: ACAAGGGGCATTTGCAATAA 56 6 4

JX853743 R: AACGTCAACGGAAGTCTCAAA

M19 (TTAT)9 F: AACAGTTCGTTTCAACCCAAA 56 4 2

JX853741 R: AAGTGAAAAGGACCTGGAAACA

M23 (AT)17 F: CAGCCGCTCTCTTGTTTTCT 56 30 12

KJ145405 R: TTTCCACGCTGGGATTTAAC

M49 (GAA)10 F: TTGTTGGTTAGAAGGCCAAGA 56 12 4

JX853742 R: CCAAAAAGCTACGGCAATGT

M50 (AAAAAT)5 F: CTCCGAGTGGGCAGTCTAGT 56 60 4

JX853744 R: AGCTCCGAGTGGAACAAGAA

M124 (TA)13 F: TTTTAAGAGGCCAAGAGGAAA 56 8 5

KJ145406 R: TGGAGGTCTTCTGTGTTGACC

Note: Accession No., GenBank accession number; Ta, Annealing temperature.

an population were used for preliminary polymorphism screening, and all of the three populations for accurate accessment.

A single freshly hatched M. incognita was washed in sterile distilled water, transferred to a sterile Eppendorf tube with 1 |L water, and then 1.5 |L proteinase K (20 ng/|L) was added to the tube. The tube was freezing and thawing 5 times in liquid nitrogen and water bath (60°C) 3 min respectively, and then incubated at 65°C for 1 h and 95°C for 10 min. Finally, the cell ly-sates were treated with a commercial kit (GE) for genome amplification according to manufacturer instruction except the incubation step was continued for 8 h. The 20 |L amplified DNA can be stored at -20°C until polymerase chain reaction (PCR) amplification. Furthermore, a concentration gradient test was done which proved that 1 | L from ten times dilution of DNA solution could be used for PCR amplification.

In our study, the potential loci were amplified as the following condition: the reaction mixture (total volume, 15 |L) of each sample contained 1 |L template DNA, 0.5 |L forward/reverse primer (10 |M), 0.5 |L dNTPs solution (25 mM), 0.2 |L MgCl2 (25 mM), 1.5 |L Taqbuffer (10x), 0.2 |L Taq DNA polymerase, and 4.6 |L distilled water. PCR was performed on a GeneAmp 9700 unit, and included the following steps: initial denaturation at 94°C for 5 min, 30 cycles of de-naturation at 94°C for 30 s each, annealing at a specific temperature depending on the locus (Table 1) for 30 s, elongation at 72°C for 1 min, and final extension at 72°C for 20 min. Candidate microsatellite bands were excised from low-melting-temperature agarose gels, and then purified with a purification kit (Transgene). The gel-purified fragments were cloned into the pGEM-T Easy vector (Promega). Sequencing of clones was done on an ABI Prism 310 genetic analyzer (Invitrogen). PCR products were analyzed in poly-

9 TEHETHKA TOM 51 № 1 2015

130

WANG et al.

300 bp 200 bp

300 bp 300 bp

200 bp

200 bp 300 bp

300 bp 200 bp

200 bp

200 bp

200 bp 200 bp

PCR patterns of 13 polymorphic microsatellite loci in 30 individuals of Hainan population. M: 100 bp DNA ladder; No. 1—30 are different individuals in Hainan nematode population.

acrylamide gels for preliminary screening and visualized by silver staining. To further evaluate the polymorphism in three populations, each forward primer of microsatellite loci selected from preliminary screening was labelled with a fluorescent dye FAM, and DNA amplifications were performed as described previously. The PCR products were analyzed using Genetic analyzer 3730 (Applied Biosystems) and Gene-mapper software (version 4.0). The molecular diversity indices, expected heterozygosity, and observed heterozy-gosity were calculated using ARLEQUIN 3.5 and GENEPOP 4.2.

1620 microsatellite loci were obtained in our research, which were suitable for design of PCR primers using our search criteria based on the M. incognita genome (Additional file). Overall, the loci numbers of di- to hexa-motifs were 144 (8.89%), 1304 (80.49%), 160 (9.88%), 9 (0.56%) and 3 (0.19%). 1041, 1078, 592 and 602 microsatellite loci from the 1620 loci respectively contained nucleotide A, T, C and G, which indicated that nucleotide A and T were the most frequently dominant microsatellite loci in M. incognita. The repeat numbers of predicted microsatellites were varied from 5 to 47.

120 microsatellite loci including 20 of two nucle-otide repeat unit, 25 of three nucleotide repeat unit, 64 of four nucleotide repeat unit, 9 of five nucleotide repeat unit, and 3 of six nucleotide repeat units, which contain the most repeat number, were chosen as the candidate microsatellites. After PCR amplified with an individual nematode from Shandong province and sequenced successfully, 88 of the 120 loci contained the predicted SSR sequence (Additional file).

For each of the 88 microsatellite loci, polyacryla-mide gel electrophoresis was carried out after PCR amplific

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»