ПРИКЛАДНАЯ БИОХИМИЯ И МИКРОБИОЛОГИЯ, 2013, том 49, № 4, с. 353-357
UDC 577.156
DIFFERENTIAL FUSION EXPRESSION AND PURIFICATION OF A CYSTATIN IN TWO DIFFERENT BACTERIAL STRAINS
© 2013 A. Gholizadeh
Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Tabriz, Iran e-mail: aghz_bioch@yahoo.co.in Received October 1, 2012
To date, the identification of the novel multifunctional properties of cysteine proteinase inhibitors "known as cystatins" is the great of interests for molecular biologists. The efficient production, purification and correctly folded form of these proteins are the most important requirements for their any basic research. To the best of our knowledge, maltose-binding protein (MBP) fusion tags are being used to overcome the impediment to their heterologous recombinant expression in Escherichia coli as insoluble and bio-inactive inclusion bodies. In the present work, to evaluate the expression efficiency of a cystatin molecule in E. coli cells by using MBP tags, the expression of Celosia cystatin was studied in two different strains of this bacterium. The quantitative analysis results based on the one-step purification yield of the fused product showed the excellency of the E. coli TBI strain in comparison to E. coli DH5a for the high-level production of active product.
DOI: 10.7868/S0555109913040053
Cysteine proteinase inhibitors (termed as cystatins) belong to a proteinaceous group of inhibitors that re-versibly inhibit the enzymatic activity of cysteine proteinases [1]. They have been originally identified in mammalians, later on a number of putative cystatin sequences have been characterized from different plants [2—10]. The plant cystatins are generally named as "phytocystatins". Like all members of the cystatin super-family, phytocystatins contain two conserved regions that interact with cysteine proteinase molecular structures. They include "G" residue at the N-terminus, "QxVxG" and "W" at the C-terminus. Moreover, phytocystatins differ from non-plant types due to the presence of a plant-specific sequence, [LVI]-[AGT]-[RKE]-[FY]-[AS]-[VI]-x-[EDQV]-[HYFQ]-N located in an N-ter-minal a-helix region [11, 12].
Various physiological and biological roles have been attributed for phytocystatins [13—18]. However, to increase the knowledge regarding the molecular structures and functions of these proteins, the efficient production and purification of their correctly folded three-dimensional structures are needed. These requirements are mostly achieved by the heterologous protein expression as recombinant or fusion products in bacterial cells. Among bacterial expression systems, Escherichia coli is the most popular one used for the production of foreign proteins in the form of recombinant products [19]. But, a major impediment to the production of recombinant proteins "included cystatins" in E. coli is their aggregation and formation of insoluble and biologically inactive inclusion bodies. Although, they can be converted into native forms, but this is a time consuming, labor-intensive, and so is a costly manner [20]. The best approach is the use of fu-
sion tags that considerably enhance the solubility of the expressed products in the recombinant cells. Among the fusion tags, maltose-binding protein (MBP) tags have been generally considered to be the best fusion partner that not only provide the high level of protein expression, but also efficiently enhance the solubility, folding and stability of the fused proteins. The other attention to MBP tags is given to its rapid expression procedure and its easy and efficient one-step purification method that is done by maltose-affinity chromatography [20—22].
To date, very limited information is available concerning the heterologous expression of phytocystatins either in the forms of recombinant or fusion partners. The use of MBP tags for the expression of plant cyst-atins was originally and frequently reported from our laboratory [8, 23—25]. These tags were found to minimally affect the fused cystatins inhibitory activity against papain in vitro. Among the studied cystatins by our research team, Celosia cristata cystatin is the most characterized one that has been shown to be involved in the inhibition of TMV (tobacco mosaic virus)-in-duced programmed cell death in the host plant [8].
According to the protocol of MBP-based expression systems (New England Biolabs, UK), TB1 strain of E. coli is being used for the transformation process [26, 27]. In the present work, as a part of our expression studies with regard to Celosia cystatin, we were interested to examine the expression as well as the bioac-tivity of the same cystatin molecule in two different types of E. coli strains (including DH5a and TB1) at the same experimental conditions. The experiments were conducted to identify the in vitro activity of the MBP-fused product, the continuity of its expression
process in recombinant cells and the of growth patterns of the test bacterial cultures.
MATERIALS AND METHODS
Materials. DH5a strain of E. coli was obtained from Genetic Engineering labratory, Department of Plant Breeding and Biotechnology, University of Tabriz (Iran). E. coli strain TBI and pMALc2X vector for bacterial transformation, recombinant vector construction, and protein expression studies were supplied in the protein fusion and purification system kit (New England Biolabs, UK). RNX™ (-plus) kit (Cin-naGen, Iran) was used for total RNA isolation. mRNA purification was done by mini prep mRNA purification kit (Qiagen, USA). RT-PCR reaction was carried out by AcessQuick™ RT-PCR System (Promega, USA). Plasmid vector pGEM-T easy used for polymerase chain reaction (PCR) product cloning was from our laboratory stock. DNA Extraction Kit (Fermentas, USA) was used for the purification of the restricted fragment from the agarose gel. Restriction enzymes EcoRI and BamHI used in the cloning procedure (CinnaGen, Iran). All the other chemicals used in this research were of molecular biology grade.
Cloning of cystatin cDNA. In order to clone cysta-tin cDNA from the leaf tissues of the Celosia plant, reverse transcriptase (RT)-PCR method was used (according to the protocol of RNX™ kit). For total RNA isolation, about 0.2 g leaf material was fine powdered using liquid N2, and 2.0 mL of RNX™ reagent was added to homogenize the powder at room temperature (RT). Next, 200 ^L of chloroform was added to the mixture, mixed for 15 s, incubated on ice for 5 min, and centrifuged at 13000 g for 15 min. The upper phase was transferred to another tube, and RNA was precipitated using an equal volume of isopropanol. The pellet was washed by 1 mL of 75% ethanol, dried at RT, and dissolved in 30 ^L of RNase-free water. Poly (A+) RNA was purified from the total RNA by using oligo dT-column according to the manufacturer's protocol.
For RT-PCR reaction, the specific primers were designed based on the already reported cystatin cDNA from Celosia plant (accession number: AJ535712) using Primer3 software at http://www.primer3plus.com/ web_0.4.0/input.htm. The nucleotide sequences of the synthetic primers were as follows:
right primer: 5'TTCCGAATTCGCAAAAATGAGTTCC3';
left primer:
5 'TTCAGGGATCCTTAGTTAGCAACGGC3'
The RT-PCR reaction was performed using one-step AcessQuick™ RT-PCR System (Promega, USA). Aproximately 0.5 ^g of each mRNA sample was mixed with 25 ^L of master mix (2x) and 1 of ^L primer set. The mixture was adjusted with nuclease-free water to a final volume of 50 ^L. The reaction mixture was incubated at 45°C for 45 min and subject-
ed to PCR cycling. Amplification was performed in Techneh type thermal cycler (Germany), with 25 cycles of 1 min denaturation at 93°C, 1.5 min annealing at 58°C, 2 min extension at 72°C, ending with 10 min of final extension at 72°C. The amplified products were then extracted from the agarose gel, and then cloned by using pGEM®-T Easy vector system [28]. The recombinant vector separately transformed to TB1 and DH5a strains of E. coli. Transformants were then spread on LB plates containing 100 ^g/mL ampi-cillin, 0.3 mM isopropyl-P-D-thiogalactopyranoside (IPTG) and 40 ^g/mL 5-bromo-4-chloro-indolyl-P-D-galactopyranoside (X-gal) and incubated at 37°C.
A single recombinant colony was selected from the plate and processed for plasmid extraction using the alkaline lysis method [29]. The isolated plasmid was digested with EcoRI restriction enzyme and separated on 0.8% agarose gel. The cloned fragments were sequenced at the Microsynth DNA Sequencing Center (Switzerland).
The nucleotide sequence of the isolated cDNA was analyzed by using BLAST server at http://www.ncbi. nlm.blast.com/.
Expression of cystatin as fused product. The RT-PCR amplification product after agarose gel purification step was digested with EcoRI and BamHI restriction enzymes, run on 1% agarose gel, extracted and purified from the gel, and ligated into the pMALc2X expression vector, which had already been linearized at the EcoRI and BamHI sites within the multiple cloning region (Fig 1). The ligation mixture was separately transferred to competent E. coli TB1 and DH5a cells. For the preparation of competent cells, bacterial cells were grown in Luria Bertani (LB) media. When the OD600 reached 0.4, the cells were kept in ice for 15 min, centrifuged at 3500 g for 10 min at 4°C, and washed with 10 mL of 100 mM CaCl2. Subsequently, they were centrifuged at 5000 g for 10 min, resuspend-ed in 2 mL of chilled 50 mM CaCl2, and kept in ice for 12 h. For the transformation of bacterial cells, the all ligation reaction product was added to 25 ^L of competent cells, incubated on ice for 5 min, heated to 42°C for 2 min, and incubated at 37°C for 20 min after addition of 0.1 mL LB medium. The transformed cells were plated on LB medium (supplemented with Amp and X-gal) at 37°C, and a recombinant clone was selected for gene expression studies.
Extraction and purification of the expressed fusion protein. In o
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.