ГЕНЕТИКА, 2008, том 44, № 4, с. 574-576
y^K 575.17
КРАТКИЕ СООБЩЕНИЯ
ELEVEN NOVEL POLYMORPHIC MICROSATELLITE DNA MARKERS FROM THE GREEN-LIPPED MUSSEL Perna viridis
© 2008 C. C. Ong1, C. H. Teh1, S. G. Tan1, K. Yusoff2, C. K. Yap1
1Genetics Laboratory, Department of Biology, Faculty of Science University Putra Malaysia, Serdang 43400, Selangor, Malaysia; e-mail: sgtan_98@yahoo.com 2Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences University Putra Malaysia
Received March 18, 2007
We report on the characterization of 11 polymorphic microsatellite loci in P. viridis, the first set of such markers developed and characterized for this species. The number of alleles per locus ranged from 2 to 7, whereas the observed heterozygosity ranged from 0.0447 to 0.4837. These markers should prove useful as powerful genetic markers for this species.
The green-lipped mussel, Perna viridis, is widely distributed in the Indo-Pacific region. This mussel is important economically and ecologically because of its widespread distribution and biological filtration activity, and also economically because of its value as a cheap source of animal protein for human consumption. More recently, this mussel has been used as a biomonitoring agent for heavy metal contamination in various Asian countries. Despite the availability of genetic information obtained through less efficient molecular markers such as allozymes, random amplified polymorphic DNA (RAPD) and random amplified microsatellite (RAM), there is no information regarding microsatellite markers in P. viridis. Here, we present the first set of microsatellite markers for this species.
Genomic DNA was isolated from P. viridis adductor muscle according to Winnepennincks et al. [1]. Four PCR-based libraries that were enriched for different microsatellite motifs were constructed by using a 5' anchored PCR technique (Table 1). It is a technique that involves the use of a single primer containing microsatellite motif anchored at the 5' end by several degenerate bases to produce a microsatellite-rich PCR profile from genomic DNA, which are then cloned to yield a genom-ic library enriched for microsatellites [2]. PCR reactions were carried out in a 10 ^l total volume containing 25 ng of genomic DNA, 1x PCR buffer, 0.2 mM each of dNTPs, 15 pmol of primers, 2.0 mM MgCl2 and
1.5 U of Taq DNA polymerase (Promega, USA). Amplifications were performed in a Peltier Thermal Cycler PTC-220 (MJ Research, USA) with an initial 3 min of predenaturation at 96°C, followed by 40 cycles of 15 s denaturation at 96°C, 15 s at an optimum annealing temperature and 30 s extension at 72°C. A final extension step of 72°C for 7 min was included for the attachment of a dATP at the 3' terminal for the cloning reaction. The PCR products were then cloned into the TOPO TA cloning vector (Invitrogen, USA). A total of 68 recombinant clones were randomly selected for DNA sequencing after plasmid extraction by using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, USA) on the ABI PRISM 377 DNA sequencer.
Primers were then designed to amplify regions containing microsatellites by using PRIMeR 3 [3]. These primers were then tested for polymorphism on 190 samples of P. viridis, collected from ten locations in Malaysia. PCR amplifications were performed in a 10 ^l final reaction volume containing 25 ng of genomic DNA, 1x PCR buffer, 0.25 mM each of dNTPs, 0.15 pM of each reverse and forward primers, 13.75 mM of MgCl2 and 0.5-1.5 U of Taq DNA polymerase (Promega, USA). Amplifications were performed in a Peltier Thermal Cycler PTC-220 (MJ Research, USA) with an initial 3 min of predenaturation at 95°C, followed by 35-40 cycles of 30 s denaturation at
Table 1. List of degenerate primers used in this study
Anchor primer name Sequence (5'-3') Annealing temperature (°C)
VJ1 NNNNNNNKKVRVRV(CT)10 56
BP2 NNNNNKKVWBDBDBDB(AC)10 55
BP9 WWWVYVYVYV(AG)8 50
BP14 KKBYSS(GATA)5 55
Note: K, G/T; V, A/C/G; R, A/G; N, A/G/T/C; Y, T/C; W, A/T; B, C/G/T; D, A/G/T and S, C/G (IUB code).
ELEVEN NOVEL POLYMORPHIC MICROSATELLITE DNA MARKERS
575
Table 2. Primer pair sequence and characteristics of 11 polymorphic microsatellite loci in Perna viridis. Number of alleles and observed and expected heterozygosities were calculated based on the analysis of 190 individuals for each locus
Locus Repeat array Primer sequence (5'—>-3') Exp. allelesize (bp) MgCl2 (mM) Ta (°C) Na Ho (He) GenBank Accesion no.
VJ1-22-2 (TG)n F: AGACGGAATGCAGTAAGAAG R: CATAAGCAGAATTCCCAGAG 198 2.0 51 2 0.0747 (0.0721) DQ010082
VJ1-9-1 (CT)n F: TGCGTGTGGAGGCTCTCT R: TCACCTCTTGGTTGAGGACA 205 3.75 40 2 0.4804 (0.3661) DQ010072
VJ1-21-2 (CT)n(CA)n F: CTAGTAGAAGCTCTCTCTCTC R: GAAGTTTTGCTCACTCATCT 224 2.5 40 2 0.0973 (0.0928) DQ010081
VJ1-15-1 (CT)„(CA)n F: GGTTGAGAGCCTCTCTCTCT R: AGGAGAATCCTGCTCTCTTC 220 2.0 42 2 0.0500 (0.0594) DQ010077
BP2-35-2 (TG)n F: CTCTTTCATCTTTCACCTC R: CGTCAGGTACTCCATATCC 222 3.75 40 4 0.0546 (0.3762) DQ010059
BP9-7-1 (AG)n(GA)n F: GTATATCAGAGAGAGAGAG R: AGGAACTGAACACTGTTTG 299 2.5 40 2 0.1033 (0.0982) DQ112051
BP9-16-2 (CT)n F: GGCAACATTAGAAGTTCTGT R: TTGTATACCAGAGAGAGAG 213 3.75 40 2 0.3904 (0.3150) DQ112058
BP9-19-2 (CT)n F: CTCCCTACTAATGAGGACAT R: TTCTATGTGAGAGAGAGAG 263 2.5 40 2 0.0447 (0.0438) DQ112060
BP14-7-1 (GATA)n F: TGAGGCGATAGATAGATAG R: GATCAACTGTTAAGCGATAG 169 2.5 45 7 0.0874 (0.6541) AY254777
BP9-27-1 (AG)n F: GTATGTCAGAGAGAGAGAG R: CACCCATAGAGTATGTCATT 268 3.75 40 3 0.2204 (0.1972) DQ 112066
BP9-13-2 (CT)n F: CTCCCTACTAATGAGGACAT R: TTCTATGTGAGAGAGAGAG 263 3.75 40 2 0.0579 (0.0564) DQ 112055
Note: N, pure; n, interrupted. Ta, annealing temperature; Na, number of allele; Ho, observed heterozygosity; He, expected heterozygosity.
94°C, 30 s at an optimum annealing temperature and 30 s extension at 68°C. The amplifications were concluded with a 5 min final extension at 68°C. The PCR products were electrophoresed on 4% MetaPhor gels (BMA, USA) and visualized with UV light after ethid-ium bromide staining. The population data were analysed using the POPGENE (Version 1.32) computer software [4].
The 68 clones sequenced revealed a total of 161 microsatellites. Primers were designed for 74 microsatellite loci. Of these, 11 were found to be polymorphic and the rest monomorphic (24) or difficult to score after
PCR amplification (39). The 11 new microsatellite markers varied widely in their degrees of polymorphisms, with the number of alleles per locus ranging from 2 to 7 and HO ranging from 0.0447 to 0.4447 (Table 2).
The results of this study showed the successful use of the 5' anchored PCR technique for isolating large numbers of microsatellite sequences from the genome of P. viridis in a short time. The screening process also revealed that despite the best efforts at primer design, it was inevitable that some microsatellite loci with apparently suitable priming sites failed to amplify. Even if
ÉEHETHKA tom 44 < 4 2008
576
ONG et al.
there was an amplification product, some of the primer pairs may fail to generate stable and consistent banding profiles or gave multibanded profiles that were uninter-pretable in terms of alleles and loci. Although some optimisation of the PCR conditions can improve the success rate, nevertheless this still represent an additional source of attrition in the process of developing a set of working polymorphic primers [5]. The primers described in this paper will be useful as powerful genetic markers for this species.
ACKNOWLEDGMENTS
The author wishes to thank Mr. Hoh Boon Peng and Dr. Vijay Kumar for providing the degenerate primers used in this study. This work was funded by IRPA grant 09-02-04-EA001: Development and application of DNA microsatellite markers for the biodiversity chara-terization of the green-lipped mussel, Perna viridis
from the Ministry of Science, Technology and the Innovation Malaysia.
REFERENCES
1. Winnepennincks, B., Backeljau, T., and Wachter, R.D., Extraction of high molecular weight DNA from mol-lusks, Trends in Genetics, 1993, vol. 9, pp. 407.
2. Fisher, P.J., Gardner, R.C., and Richardson, T.E., Single locus microsatellites isolated using 5' anchored PCR, Nucl. Acids Res., 1996, vol. 24, pp. 4369-4371.
3. Rozen, S., and Skaletsky, H.J., Primer3, 1997. Code available at http://www-genome.wi.mit.edu/genome_software/ other/primer3.html.
4. Yeh, F.C., and Boyle, T.J.B., Population genetic analysis of co-dominant and dominant markers and quantitative traits, Belgian J. Bot, 1997, vol. 129, pp. 157.
5. Squirrell, J., Hollingsworth, P.M., Woodhead, M., et al., How much effort is required to isolate nuclear microsatellites from plants? Mol. Ecol, 2003, vol. 12, pp. 13391348.
ОДИННАДЦАТЬ НОВЫХ ПОЛИМОРФНЫХ МИКРОСАТЕЛЛИТНЫХ
ДНК-МАРКЕРОВ МИДИИ Perna viridis
К. К. Онг1, К.Х . Те1, С. Г. Тан1, К. Юсофф2, С. К. Яп1
1Genetics Laboratory, Department of Biology, Faculty of Science, University Putra Malaysia,
Serdang, Selangor, 43400 Malaysia; e-mail: sgtan_98@yahoo.com 2Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, University Putra Malaysia,
Serdang, Selangor, 43400 Malaysia
Одиннадцать полиморфных микросателлитных локусов впервые описаны у мидии Perna viridis. Число аллелей на локус варьировало от двух до семи, тогда как наблюдаемая гетерозиготность составила 0.0447-0.4837. Данные локусы могут использоваться как генетические маркеры этого вида.
Сдано в набор 19.12.2007 г. Подписано к печати 22.02.2008 г. Формат бумаги 60 х 881/§
Цифровая печать Усл. печ. л. 18.0 Усл. кр.-отт. 5.3 тыс. Уч.-изд. л. 18.0 Бум. л. 9.0
Тираж 287 экз. Зак. 35
Учредители: Российская академия наук, Институт биологии гена РАН, Институт общей генетики им. Н.И. Вавилова РАН
Издатель: Академиздатцентр "Наука", 117997 Москва, Профсоюзная ул., 90
Оригинал-макет подготовлен МАИК "Наука/Интерпериодика" Отпечатано в ППП "Типография "Наука", 121099 Москва, Шубинский пер., 6
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.