ПРИКЛАДНАЯ БИОХИМИЯ И МИКРОБИОЛОГИЯ, 2014, том 50, № 3, с. 324-328
UDC 582.282.23
ERYTHRITOL PRODUCTION WITH MINIMUM BY-PRODUCT USING
Candida magnoliae MUTANT
© 2014 G. R. Ghezelbash*, I. Nahvi*, and A. Malekpour**
*Department of Biology, Faculty of Science, University of Isfahan, 81746-73441, Iran ** Department of Chemistry, Faculty of Science, University of Isfahan, Isfahan 81746-73441, Iran
e-mail: gh.r.ghezelbash@gmail.com Received 26.09.2013
In order to enhance erythritol production, mutants of Candida magnoliae DSM70638 were generated by ultraviolet and chemical mutagenesis. Erythritol productivity of samples was analyzed by TLC and HPLC with the refractive index detector. One of the mutants named mutant 12-2 gave a 2.4-fold increase in erythritol (20.32 g/L) and a 5.5-fold decrease in glycerol production compared to the wild strain. A sequence-based map of erythrose reductase gene in this mutant showed a replacement of the A321 by G321 that did not cause any amino acid exchange in protein structure. Therefore, the reason of higher erythritol production in C. magnoliae mutant 12-2 is probably the increase in expression of the open reading frame gene. This study revealed that a mutation or minor change in the sequence of genes involved in a production pathway can lead to a significant increase in protein translation.
DOI: 10.7868/S0555109914030192
Erythritol or meso-erythritol is a four-carbon sugar alcohol with molecular weight of 122 and a melting point of 119°C [1]. It is a white crystalline compound with 70—80% of the sweetness of sucrose [2]. Erythri-tol has been frequently used in food industry as a sugar substitute due to its nontoxic and noncaloric nature. Several studies have shown that this compound may decrease the microplate surface adherence of oral streptococci by decreasing the rate of polysaccharide production [3].
It has been reported that different osmophilic yeasts including Aureobasidium, Candida, Moniliella, Pichia, Pseudozyma, Trigonopsis, Trichosporon, Tri-chosporonoides, and Yarrowia can produce erythritol, which was the first sugar alcohol to be produced commercially by fermentation [4]. This sweetener was commercially produced using a mutant of Aureobasidium sp. with a high yield of 44% (g/g) in a medium containing 40% glucose. Wild type Aureobasidium sp. was isolated from the soil of a sugarcane plantation in Okinawa (Japan) [2, 5].
Erythritol is synthesized from erythrose 4-phos-phate, an intermediate of the pentose phosphate cycle, by dephosphorylation followed by reduction of the resultant erythrose. Erythrose reductase (ER), catalyzing the last reaction, is well known as a key enzyme for the biosynthesis of erythritol [6].
The aim of the present study was to enhance ER activity and decrease glycerol production in Candida magnoliae DSM70638 by mutagenesis. We also examined the effect of environmental factors on erythritol production in obtained mutant.
MATERIALS AND METHODS
Microorganisms and media. C. magnoliae DSM70638 (Leibniz institute DSMZ, Germany) was used for making mutants. This strain was maintained on malt extract-glucose-yeast extract-peptone (MGYP) agar [6]. The erythritol and glycerol production by the mutants was followed using production medium. The production medium contained (g/L): yeast extract — 10; KH2PO4 — 5; MgSO4 - 0.25 and glucose - 200, pH 5.5.
Culture conditions. We inoculated a pure culture of C. magnoliae DSM70638 in 10 mL of production medium in a 100 mL Erlenmeyer flask that was incubated at 30°C and 180 rpm for 48 h [7]. At the next stage, 0.5 ml of this seed culture was aseptically transferred to 100 mL flasks containing 9.5 mL production medium and they were incubated at 30°C and 180 rpm for 168 h [6]. Samples were withdrawn and analyzed for dry cell weight, residual substrate and the end products once every 24 h.
Mutagenesis. Wild type C. magnoliae DSM70638 strain was cultured in yeast extract-peptone-dextrose (YPD) [6] broth for 2 days. The culture broth was cen-trifuged at 5000 x g and the cells were washed twice with sterile physiological saline. The pellet was resus-pended in sterile physiological saline, the cell count was adjusted to 1 x 105 cells/mL using a Thoma cell counting chamber, and 2 mL of this suspension was irradiated by UV light (Uvitec, England) for various periods oftime (30, 60, 80, 120, 150, and 180 s). The mutants with high ER activity were selected for further chemical treatment. For chemical mutagenesis, 5 mL of cell suspension with 1 x 105 cells/mL was treated
ERYTHRITOL PRODUCTION WITH MINIMUM BY-PRODUCT
325
with 20 |L ethyl methanesulfonate (EMS) (Sigma, USA) at various periods oftime (15, 30, 40, and 60 min). For inactivation of EMS, 0.5 mL of filter-sterilized 5% sodium thiosulfate was added to 0.5 mL of treated cell suspension [6].
Mutant selection. Following irradiation, for screening the mutants with high ER activity, 20 |L mutagen-treated cell suspension was spread on production medium plates with 2% agar, 400 or 600 g/L glucose and 0.1 g/L triphe-nyl-tetrazolium chloride (TTC) (Sigma, USA) and then was incubated at 30°C for 5—6 days [4, 6, 8]. Colonies with different colors and sizes were tested to reveal the colonies with higher erythritol production, higher glucose utilization and minimal by-products formation. The obtained results were compared with those for the wild strain. The C. magnoliae DSM70638 mutants with larger colonies of dark red color were selected and maintained at 4°C in slant of YPD agar until further study [6, 8].
Preparation of cell extracts. Equal amounts of the cultures were harvested by centrifugation at 5000 x g for 30 min and then stored on ice. Harvested cells were washed twice with 50 mM potassium phosphate buffer, pH 7.0, with 5.0 mM mercaptoethanol and then resus-pended in the homogenization buffer containing 50 mM potassium phosphate buffer, pH 7.0, with 10 mM MgCl2, and 1 mM dithiothreitol (DTT) (Merck, Germany). The cell suspension was incubated for 1 h at room temperature and then homogenized by grinding with 0.5-mm diameter glass beads. Samples were centrifuged at 9000 x g for 30 min at 4°C in order to precipitate the cell debris. The obtained supernatants were used for enzyme assay and determination of total protein [9].
Measurement of protein concentration and ER activity assay. Protein concentration was measured using the Bradford method with BSA as a standard and ER activity was determined with 12 mM erythrose and 4 mM NADPH containing in 50 mM phosphate buffer (pH 6.5) by monitoring the decrease of OD340 at 37°C for 10 min [10, 11]. One unit of ER activity was defined as the amount of enzyme that catalyzed the oxidation of 1.0 |mol of NADPH per min at 37°C. Specific ER activity was expressed as units of enzyme activity per mg of cellular protein.
DNA isolation, PCR and sequencing of ER gene.
Genomic DNA from the wild and mutant strains of C. magnoliae was extracted using the Hoffman method with glass bead disruption [12]. The yeasts, after activation on YPD agar, were cultured in YPD broth and the cells were collected by centrifugation at 5000 x g for 10 min. Cell pellets were washed 3 times with deioni-zed water and then harvested finally for extraction of DNA. 300 |L of lysis buffer (10 mM Tris-HCl with 1 mM EDTA, 100 mM NaCl, 1% SDS, and 2% triton X-100; pH 8.0), 300 mg of 0.5 mm diameter glass beads, and 200 |L of phenol-chloroform-isoamyl alcohol (25 : 24 : 1) mixture were added to the cell pellet
and agitated vigorously for 5 min, then 200 |L of TE buffer (10 mM Tris-HCl with 1 mM EDTA; pH 7.6) was added, slowly mixed and re-centrifuged for 5 min at 10000 x g. The supernatant was transferred to a new tube and cold isopropanol (double volume) was added. After mix by inverting the tube and centrifugation, the resulting DNA pellet was air-dried, dissolved in 100 |L of TE and then stored at -20°C until used for PCR.
Coding region for the ER ORF was amplified with ER1 (ATGTCTTCGACCTACACCCTTAC) and ER2 (TCACCGTCTTGCTAGCGC) as forward and reveres primers, respectively [13]. In brief, PCR amplifications were performed in a total volume of 25 |L, containing 2.5 |L 10 x PCR buffer, 0.75 |L MgCl2 (25 mM), 0.5 |L dNTPs (0.2 mM), 1 |L ER primers, 0.25 |L Taq polymerase (5U/|L), 17 |L PCR H2O and 2 | L genomic DNA. After initial denaturation at 95°C for 5 min, PCR was followed by 30 cycles of 30 s at 95°C, 30 s at 56°C and 2 min at 72°C, and one cycle of10 min at 72°C [13]. An approximately 850 bp DNA fragment was amplified, separated on a 1.7% agarose gel containing ethidium bromide in 1 x TBE buffer, run at 100 V for 1.5 h and visualized on a UV transilluminator (Syngene, USA). The fragment was sequenced by sequencer from Sequetech Co. (USA). Analysis of the wild and mutation DNA sequences was performed using CLC Genomics Workbench (V4.5, CLC Bio, Aarhus, Denmark).
Optimization of media components for erythritol production by C. magnoliae mutant 12-2. Erythritol production by C. magnoliae mutant 12-2 was examined at 30°C and 180 rpm for 7 days in 100 mL flasks in the presence of various glucose concentrations, nitrogen sources and initial pH values as several environmental factors using the "one factor at a time" method. For studying the effect of glucose concentration on production, 0.5 mL of the preculture was inoculated into 9.5 mL production medium with different glucose concentrations (200—350 g/L) [5]. The rates of glucose utilization by C. magnoliae DSM70638 and the mutant 12-2 were also studied and compared. Yeast extract as the most common nitrogen source was substituted with NaNO3, (NH4)2SO4 or urea in two concentrations (5 and 10 g/L) [14]. The optimal pH for erythritol production was examined at range pH from 4.0 to 6.5 under the same conditions as described above [5].
Analytical methods. The dry weight of yeast cells was measured by centrifugation of a sample of the culture liquid, washing the yeast twice with distilled water and d
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.