ГЕНЕТИКА, 2014, том 50, № 10, с. 1259-1262
КРАТКИЕ СООБЩЕНИЯ =
УДК 575:595.132
EST-SSR MARKERS FROM Heterodera glycines Ichinohe © 2014 H. M. Wang1, H. H. Zhao1, C. Z. Zhao2, D. Chu1
1Key Lab of Integrated Crop Pest Management of Shandong Province, College of Agronomy and Plant Protection, Qingdao Agricultural University, Qingdao, 266109, P.R. China e-mail: chinachudong@sina.com; hhzhao@qau.edu.cn 2Bio-Tech Research Center, Shandong Academy of Agricultural Sciences; Shandong Provincial Key Laboratory of Crop Genetic Improvement, Ecology and Physiology, Jinan 250100, P.R. China
Received March 31, 2014
The soybean cyst nematode Heterodera glycines Ichinohe is a severe agricultural pest for which genetic resources are limited. In this study, 295 simple sequence repeats (SSRs) were identified from 259 expressed sequenced tags (ESTs), which were selected from 9,443 unigenes. The successful primer pairs were designed against six regions. In total, 30 alleles were identified from 30 individuals using the six markers, with an average of five alleles per locus (range, 4—7). The observed and expected heterozygosities were 0.074—0.900 and 0.266—0.775, respectively. Significant departure from Hardy—Weinberg equilibrium was found at three of the six loci. The EST-based SSR markers developed in this study may contribute to better understanding of the genetic structure of H. glycines populations.
DOI: 10.7868/S0016675814100154
The soybean cyst nematode Heterodera glycines Ichinohe was first discovered in North East China in 1899 and has since spread worldwide [1], causing devastating soybean (Glycine max) yield losses [2]. The heavily affected areas could reach about 30.0 million hectares happened in Heilongjiang province of China northeast region in 2006. Although leguminous plants are the main cultivated hosts, more than 1,100 plants species have been identified as potential soybean cyst nematode hosts [3]. The severe agricultural economic impact of these infestations necessitates further research into H. glycines, particularly with respect to population genetics, because data are limited [4]. Simple sequence repeats (SSRs) are DNA sequences containing tandemly repeated units (1—6 bp) [5] with highly variable repeat numbers, and considered to be the suitable markers for population genetic structure analysis, gene mapping, and isolate identification [6, 7] owing to its abundance in genome, co-dominant inheritance and high level of polymorphism [8—10]. In some fields, expressed sequence tags (ESTs) have been used to identify SSR markers rather than using genomic sequences. EST-based SSR development has several advantages over genomic SSRs, such as increased development speed, reduced costs, and broad transferability between species [11]. In this article, we report the first set of EST—SSRs for H. glycines, the success of which will contribute to the development of genetic studies in this organism.
A total of 26,172 H. glycines EST sequences were downloaded from the NCBI. In total, 9,443 unigenes were detected, comprising 5,337 singletons and 4,106
contigs. The MISA (MIcroSAtellite) program (http:// pgrc.ipk-gatersleben.de/misa/misa.html) was used to detect SSR loci by screening for at least six repeats of dinucleotide, at least five repeats of tri-, tetra-, and pentanucleotide microsatellite. In total, 295 SSR loci from 259 EST sequences were identified. The 295 SSRs mainly comprised trinucleotide (193/295) and dinucleotide (96/295) repeats, with tetranucleotide (5/295) and pentanucleotide (1/295) repeats being uncommon. Among the trinucleotide repeats, AGG/CCT motifs were the most common (42/193; 21.8%), followed by AAC/GTT (36/193; 18.7%). Among the di-nucleotide repeats, AG/CT were the most common (86/96; 89.6%). Tetranucleotide and pentanucleotide repeats showed lower occurrence frequencies. Twelve primer pairs were designed flanking sequences, and each sequence contained at least seven motif repeats. Primers were designed using PRIMER PREMIER 5.0 software [12].
30 adult H. glycines were collected from soybean from Shandong Province in China in 2013. Cysts were isolated by flotation from soil samples and stored at 4°C [13]. DNA was extracted from juvenile. Each juvenile was placed into an individual Eppendorf tube containing 14 ^L distilled water and incubated at — 80°C for at least 20 min. Tube contents were then crushed using sterile pestle and 3 ^L 10x polymerase chain reaction (PCR) buffer and 3 ^L proteinase K (600 ^g/mL) were added. Tubes were incubated at 65°C for 60 min, then at 95°C for 10 min, and were finally cen-trifuged (2 min at 12,000x g). The DNA-containing supernatant was stored at —20°C and used for subsequent
Expressed sequence tags-simple sequence repeats used to identify polymorphisms in 30 H. glycines individuals
Locus SSR Primer sequences (5'-3') T °c -'a; ^ Size, bp ^a Ho HE Fis P Accession no.
GL01 (CAG)14 F: FAM-GTCTCAATCCCCAACAGTAA R: CACATGCGTAGCCGAAAT 55 435-444 4.000 0.333 0.684 0.518 0.000* CB825825
GL02 (TC)n F: HEX-GCTTTTCCTACAACCGATAC R: CACATATTTGGGGTCTTCC 55 381-397 7.000 0.560 0.775 0.281 0.054 CB378155
GL03 (AG)9 F: FAM-TACTGCAAACTATTCCAACG R: TTTCCATGCGATCACTCT 52 426-442 6.000 0.607 0.664 0.087 0.056 BI748802
GL 05 (GA)g F: TAMRA-CGATGAAAACGAACGACA R: CACAGACAAAACCCGAAA 52 250-256 4.000 0.308 0.635 0.520 0.000* CA940861
GL10 (AG)7 F: HEX-TCAACCTGAAACCACGAG R: CTTACTCTGTGAAGGACGGT 55 251-257 3.000 0.074 0.266 0.725 0.000* CA940385
GL12 (GGA)7 F: TAMRA-CAACAACCGCAGAAACAA R: CAACAGTAGTAACGACGACAAT 53 228-260 6.000 0.900 0.718 -0.260 0.051 CB378922
Note: Ta, annealing temperature; Na, number of detected alleles; Hq, observed heterozygosity; i/g, expected heterozygosity; i^g, estimator of the fixation index; P, probability value of Hardy—Weinberg equilibrium (* indicates significance at P< 0.05); NCBI accession number for original downloaded sequences.
EST-SSR MARKERS
1261
PCR amplification. PCR amplification was performed in 13 |L volumes containing 0.13 |L Taq DNA polymerase (5U/|L) 1.3 |L 10x Easy Taq PCR Buffer, 0.26 |L of each dNTP (10 |M), 0.26 |L of each primer (10 |M), and 2 |L DNA. PCR conditions were as follows: initial denaturation at 94°C for 4 min; 35 cycles of 30 s at 94°C, 45 s at primer-specific annealing temperature (52—55°C) (Table), 2 min at 72°C; and a final elongation step at 72°C for 7 min. Forward primers were labeled on the 5' end with fluorescent dye 6-carboxyfluorescein (FAM), 5-hexachloro-fluores-cein (HEX), or 5-carboxytetramethylrhodamine (TAM-RA). The PCR products were run on an ABI 3730xl DNA analyzer and allele size was determined by the method of comparing the mobility of PCR products to the GeneScanTM 400HD size standard (Applied Biosystems).
Number of detected alleles per locus, and observed and expected heterozygosity were calculated using POPGENE v. 1.31 [14]. FIS values based on Weir and Cockerham [15] and Hardy—Weinberg exact tests were calculated with GENEPOP v. 3.4 [16].
Six of the 12 primer pairs (Table) readily produced amplicons and revealed polymorphisms in the 30 H. glycines individuals that were tested. In total, 30 alleles were identified using the six markers, with 4—7 alleles detected per locus (average of five per locus). Observed and expected heterozygosities were 0.074— 0.900 and 0.266—0.775, respectively. Significant departure from Hardy—Weinberg equilibrium was found in three loci (GL01, GL05, and GL10). These results suggest that the EST-based SSR markers developed in this study can be used to reveal the genetic structure of H. glycines populations. These results also indicate the EST can provide a valuable resource for developing SSR markers, which was consistent with the prior studies [11, 17].
ACKNOWLEDGMENTS
This research was supported by the Science and Technology Program of China National Tobacco Corporation (110200902065), the Special Fund for Agro-Scientific Research in the Public Interest (200903040), the Science and Technology Development Planning Program of Qingdao (13-1-3-108-nsh), and the Taishan Mountain Scholar Constructive Engineering Foundation of Shandong. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
REFERENCES
1. Heydari, R., Maafi, Z.T., and Pourjam, E., Yield loss caused by soybean cyst nematode, Heterodera glycines, in Iran, Nematology, 2012, vol. 14, pp. 589-593.
2. Masler, E.P. and Rogers, S.T., Effect of cyst components and low temperature exposure of Heterodera glycines eggs on juvenile hatching in vitro, Nematology,
2011, vol. 13, pp. 837-844.
3. European and Mediterranean Plant Protection Organization, Heterodera glycines: Procedures for official control, EPPO Bulletin, 2008, vol. 38, pp. 410-413.
4. Plantard, O. and Porte, C., Population genetic structure of the sugar beet cyst nematode Heterodera schachtii: a gonochoristic and amphimictic species with highly inbred but weakly differentiated populations, Mol. Ecol, 2004, vol. 13, pp. 33-41.
5. Ryzhova, N.N., Martirosyan, E.V, and Kochieva, E.Z., Analysis of microsatellite locus polymorphism in potato (Solanum tuberosum) cultivars of russian breeding, Russ. J. Genet, 2010, vol. 46, no. 4, pp. 425-430.
6. De Luca, F., Reyes, A., Vferonico, P., et al., Characterization of the (GAAA) microsatellite region in the plant parasitic nematode Meloidogyne artiellia, Gene, 2002, vol. 293, pp. 191-198.
7. Thiéry, M. and Mugniery, D., Microsatellite loci in the phytoparasitic nematode Globodera, Genome, 2000, vol. 43, pp. 160-165.
8. Meng, Y., Zhang, Y., Liang, H.W., et al., Genetic diversity of chinese giant salamander (Andrias davidianus) based on the novel microsatellite markers, Russ. J. Genet.,
2012, vol. 48, no. 12, pp. 1227-1231.
9. Melnikova, M.N., Petrov, N.B., Lomov A.A., et al., Testing of microsatellite primers with different populations of eurasian spruces Picea abies (L.) Karst. and Picea obovata Ledeb, Russ. J. Genet., 2012, vol. 48
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.