ГЕНЕТИКА ЖИВОТНЫХ
УДК 575:599.73
Estimation of genetic diversity in Siri cattle from India
© 2008 r. Rekha Sharma, A. K. Pandey, Y. Singh, B. P. Mishra, P.K. Singh, and G. Singh
National Bureau of Animal Genetic Resources, Karnal-132 001 (Haryana), India; e-mail: rekvik@rediffmail.com; rekvik@gmail.com Recived December 20, 2006
Siri cattle, a dual purpose breed of India is currently showing declining population trend. Siri animals have been developing through natural selection and show high adaptation to wide range of hilly terrain (altitudes 150-2500 m). The present work evaluated the genetic diversity of 23 FAO recommended microsatellite loci in a sample of 50 animals. The allele and genotype frequencies, heterozygosities and gene diversity were estimated. A total of 141 alleles were detected by the 23 microsatellite markers investigated. Microsatellites were highly polymorphic with mean allelic number 6.13 ± 1.63 (ranging from 3-10 per locus). The observed heterozygosity in the population varied from 0.26-0.80 with the mean of 0.53 ± 0.16, indicating substantial genetic variation in this population. Heterozygote deficiency and mutation-drift equilibrium hypothesis were also examined. Population exhibited heterozygote deficit to the tune of 22.1%. Population was found to be in mutation-drift equilibrium. Substantial genetic variability verified in Siri cattle despite its reducing population size suggests that this breed has a rich reservoir of genetic diversity. This fact and its marked environmental adaptation reinforce the importance of its preservation as a pure breed, and/or its use in agricultural exploitation.
International breeding strategies have intensified the economic competition among breeds. The promotion of few selected breeds for dairy and beef production has led to the replacement of less productive breeds with more productive ones and increased the number of endangered breeds globally. However, traditional breeds are often well adapted to local environment, animal husbandry practices and feeding; the breeds can have resistance to local diseases and are important from historical point of views. To change this scenario, more attention is being focused on the maintenance of animal genetic diversity than in the past. Activities have been initiated on scientific, political and administrative levels. The enormous and diverse cattle genetic resources of India are signified in the form of 30 documented breeds of zebu cattle besides numerous populations yet uncharacterized and undefined [1].
The Siri is small sized zebu cattle of hill region. Animals of this breed are found in the hilly tracts of West Bengal (Darjeeling district) and Sikkim states of India. Sikkim is situated in an ecological hotspot of the lower Himalayas, one of the three Ecoregions of India. Bhutan is said to be the real home of this breed [2]. The Siri cattle are by far the most important species and breed in Bhutan. It is distributed from that area to the various parts of Sikkim and Darjeeling. Presumably Siri cattle have some blood from the cattle in Tibet. Small cattle with similar black and white markings have been found in Sikong Province of China, which occupies a portion of the Tibetan highlands northeast of Bhutan.
The color most frequently seen is black and white or extensive solid black. Color patterns are similar to that of Holstein-Friesians. The Siri has a hump that is thoracic and muscular-fatty (Fig. 1). The position of the
hump is slightly forward compared with that of other Zebu breeds. The animal carries a thick coat all the year around, it protects them from heavy rains and severe cold. The general form of the animal is massive. Strong legs and feet are characteristics of this breed. It is observed that the animals of this breed can stand the rugged conditions of the mountains very well. Bulls are eagerly sought after for draft purposes due to their size and reputed great strength. They are also used for agricultural work such as ploughing, cultivating and threshing.
The studies of genetic variation provide an understanding of the current and historical evolutionary processes that have generated biodiversity patterns, the preservation of which should be an important compo-
Fig. 1. A representative Siri bull.
1532
ESTIMATION OF GENETIC DIVERSITY IN SIRI CATTLE FROM INDIA
1533
China (Tibet)
Nepal
China (Tibet)
West Bengal
Fig. 2. Breeding tract of Siri cattle.
nent of conservation plans. By using microsatellite markers, it is possible to verify the genetic diversity of cattle breeds and through that evaluate the level at which genetic variation is being lost or restructured in these populations [3-7]. The basic purpose of this study was to evaluate the genetic variability, heterozygote deficiency and genetic bottleneck in Siri cattle with bovine specific microsatellite markers.
MATERIALS AND METHODS
Sample collection
Random blood samples were collected from unrelated Siri animals. Sampling was done from the breeding tract, West and South Sikkim (Fig. 2) as per the guidelines of MoDAD (Measurement of Domestic Animal Diversity) programme [8]. In the field conditions animal records are not maintained by the farmers. Thus to avoid relationship, owners were interviewed in detail about ancestry before taking the samples. Blood samples (5-6 ml) were collected in vacuitaners containing ethylene diamine tetra acetic acid (EDTA) as anticoagulant.
Molecular techniques
Blood samples were processed for isolation of genomic DNA by the method of Sambrook et al. [9] with slight modifications. A set of 23 microsatellite markers (Table 1) recommended for cattle in FAO's MoDAD programme were utilized for generating microsatellite genotype data in a panel of 47 animals. Since microsatellite markers are co-dominant, 47 samples correspond to 94 alleles for each microsatellite locus. These loci and 47 samples would create 2,162 allelic data for the population included in this study.
Polymerase Chain Reaction (PCR) was performed utilizing 50-100 ng genomic DNA in a 25 ^l reaction volume using PTC-200 PCR machine (M J Research Inc., MA, USA). The PCR procedure comprised of initial denaturation at 94°C for 1 min, 30 cycles of '92°C for 1 min, precise annealing temperature of primer for 1 min, 72°C for 1 min' and finally extension at 72°C for 5 min. The PCR products were resolved on 6% denaturing polyacrylamide gels (Sequi GT System, Bio-Rad) and sized using a 10 bp ladder (Invitrogen, Life Technologies, CA, USA) as standard for sizing. Gels were stained using silver staining [10] and genotypes were scored manually. Size of the alleles was calculated online using 'INCHWORM' programme (http://www.mo-lecularworkshop.com/programs inchworm.html).
Statistical analysis
Observed and expected heterozygosity estimates were computed after Levene [11] and Nei [12] as executed in POPGENE software [13]. The observed and effective numbers of alleles (No and Ne) [14] and Ewens-Watterson neutrality test [15] were also evaluated applying POPGENE software. Allelic frequencies were utilized for assessing Polymorphic Information Content (PIC) values [16]. The PIC value was estimated as per formula
k k-1 k
pic = 1 - X XX 2x2,
i = 1 i = 1 j = i+1
where k is the number of alleles and xi and Xj are the frequencies of the ith and jth alleles respectively.
Linkage (Genotypic) disequilibrium among the microsatellite loci was analyzed employing F-STAT version 2.9.3, an update version 1.2 [17] for all microsatellite loci. Heterozygote deficiencies were articulated
Table 1. Allele range and PIC values along with chromosomal location and annealing temperature of microsatellite markers used
No. Marker Primer sequences Chromosome location Annealing t°C Allele range (bp) PIC
1 INRA35 atcctttgcagcctccacattg, ttgtgctttatgacactatccg 16 55 104-128 0.620
2 ILSTS054 gaggatcttgattttgatgtcc, agggccactatggtacttcc 21 55 135-149 0.756
3 ETH3 gaacctgcctctcctgcattgg, actctgcctgtggccaagtagg 19 64 102-124 0.619
4 HAUT24 ctctctgcctttgtccctgt, aatacactttaggagaaaaata 22 52 110-132 0.705
5 CSSM66 acacaaatcctttctgccagctga, aatttaatgcactgaggagcttgg 14 60 178-196 0.613
6 HAUT27 ttttatgttcattttttgactgg, aactgctgaaatctccatctta 26 55 129-157 0.642
7 MM12 caagacaggtgtttcaatct, atcgactctggggatgatgt 9 55 102-134 0.610
8 INRA63 atttgcacaagctaaatctaacc, aaaccacagaaatgcttggaag 18 55 158-170 0.560
9 ETH225 gatcaccttgccactatttcct, acatgacagccagctgctact 9 57 138-152 0.727
10 ETH10 gttcaggactggccctgctaaca, cctccagcccactttctcttctc 5 55 204-226 0.654
11 HEL5 gcaggatcacttgttaggga, agacgttagtgtacattaac 21 55 160-176 0.528
12 ILSTS034 aagggtctaagtccactggc, gacctggtttagcagagagc 5 57 142-200 0.594
13 HEL1 caacagctatttaacaagga, aggctacagtccatgggatt 15 55 113-131 0.688
14 ILSTS011 gcttgctacatggaaagtgc, ctaaaatgcagagccctacc 14 58 263-271 0.523
15 BM1818 agctgggaatataaccaaagg, agtgctttcaaggtccatgc 23 58 252-278 0.764
16 MM8 cccaaggacagaaaagact, ctcaagataagaccacacc 2 55 139-149 0.503
17 INRA05 caatctgcatgaagtataaatat, cttcaggcataccctacacc 12 55 135-147 0.704
18 ETH152 tactcgtagggcaggctgcctg, gagacctcagggttggtgatcag 5 55 194-210 0.340
19 ILSTS005 ggaagcaatgaaatctatagcc, tgttctgtgagtttgtaagc 10 55 180-194 0.621
20 ILSTS030 ctgcagttctgcatatgtgg, cttagacaacaggggtttgg 2 55 149-157 0.816
21 ILSTS006 tgtctgtatttctgctgtgg, acacggaagcgatctaaacg 7 56 283-309 0.630
22 HEL9 cccattcagtcttcagaggt, cacatccatgttctcaccac 8 59 148-170 0.797
23 CSRM60 aagatgtgatccaagagagaggca, aggaccagatcgtgaaaggcatag 10 55 94-121 0.759
mean 0.645 ± 0.10
as FIS= (Ho - He)/He, where Ho and He are the observed and expected frequency of heterozygotes, respectively. Finally, the bottleneck hypothesis was explored exercising BOTTLENECK 1.2.01 software [18].
RESULTS
A total of 141 alleles were detected in Siri cattle across the 23 loci investigated. Five pair of loci viz. ILSTS054-HEL5, CSSM66-ILSTS011, ILSTS005-CSRM60, MM12-ETH225 and ILSTS030-MM8 were on chromosome number 21, 14, 10, 9 a
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.