ГЕНЕТИКА МИКРООРГАНИЗМОВ
УДК 575.86:579.821
FURTHER RESOLVING THE PHYLOGENY OF MYXOGASTRIA (SLIME MOLDS) BASED ON COI AND SSU rRNA GENES
© 2015 Q. Sh. Liu, Sh. Zh. Yan, and Sh. L. Chen
College of Life Sciences, Nanjing Normal University, No. 1 Wenyuan Road, Qixia District, Nanjing 210046, China e-mail: liuqisha2006@163.com; yanshuzhen@njnu.edu.cn; chenshuanglin@njnu.edu.cn
Received April 30, 2014
To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1a) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COI) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phy-logenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Licei-da and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species.
DOI: 10.7868/S0016675814110071
The Myxogastria (also known as Myxomycetes) are plasmodial slime molds, eukaryotic microorganisms that occur in terrestrial ecosystems and aquatic habitats [1]. Their life cycle includes two trophic stages: one consists of uninucleate amoeboid or flagellate cells, and the other is a complex macroscopic multi-nucleate form (plasmodium) that can achieve macroscopic dimensions. Under favorable conditions, the plasmodium is mobile, giving rise to one or more fruiting bodies that contain spores. However, under unfavorable conditions, a plasmodium can change into a hardened, resistant structure called a microcyst or sclerotium, to survive until conditions improve [2]. DNA sequence analysis supported the view that Myxogastria belong in supergroup Amoebozoa of the Protist Kingdom [3, 4].
Class Myxogastria has traditionally included five orders: Liceida, Trichiida, Echinostelida, Physarida, and Stemonitida [5]. The ordinal-level phylogeny has long been controversial, with scholars proposing different phylogenies based on morphological features. Martin and Alexopoulos [5] placed the order Echinostelida in a central position within Myxogastria, further splitting it into Liceida, Trichiida, and Physarida, clustered in three parallel clades, with Stemonitida forming a separated clade. Ross [6] observed that the development of sporophoresis was epihypothallic in Stemonitida, with the hypothallus formed on the lower surface of the plasmodium, while Liceida, Trichii-da, Echinostelida, and Physarida were subhypothallic. Collins [7] based the characteristic of plasmodia suggested the Physarida was the most primitive, possessing phaneroplasmodia, it was further divided into
Echinostelida which has a protoplasmodium, Ste-monitida with a phaneroplasmodium, Liceida with a protoplasmodium or phaneroplasmodium, and finally Trichiida, which has an intermediate between a aph-aneroplasmodium and phaneroplasmodium.
Several efforts are now underway to develop a molecular phylogeny for Myxogastria. The phylogenic studies undertaken to date have been based mainly on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1a) sequences, and the results have indicated that the two types ofgenes can better reflect the myxogastrian phylogenetic relationship at different levels. An initial phylogenetic study based on molecular data suggested that Echinostelida, whose members produce sporocarps with a simple structure, represent the most basal clade of myxogastria [8]. The existence of two more advanced groups has also been proposed, one characterized by bright-color spores and consisting of Trichiida and Liceida, and the other characterized by dark spores and comprising Physarida and Stemonitida [8, 9]. More recent analyses based on the SSU rRNA gene [4, 10, 11] have defined the primary phylogenetic bifurcation within Class Myxogastria as a split between the dark-spored superorder Columellidia (orders Trichiida and Liceida) and the bright-spored superorder Lucisporidia (orders Physarida and Stemonitida). In addition, Echinostelida was the basal group of the superorder Lucisporidia. However, the sequences of EF-1a genes were too conserved to provide enough informative sites for resolution of the branches in superorder Columellidia [4, 11]. Hence, SSU rRNA can be used to analyze the higher-order phylogeny of myxogastria,
Table 1. List of species used to assess the phylogeny of myxogastria based on COI and SSU rRNA gene sequences
Order Species Specimens Origin GenBank accession number
COI SSU rRNA
Echinostelida Clastoderma debaryanum GenBank AF239228
Barbeyella minutissima GenBank JQ031956
Liceida Lycogala epidendrum MCCNNU00141 Datong, Qinghai KF743881 KF743868
GenBank JX481300
Trichiida Arcyria cinerea GenBank AF239226 JX481281
Physarida Diachea leucopodia MCCNNU00134 Liupan Mountain, Ningxia KF743874 KF743862
Diachea splendens MCCNNU00037 Jinzhai, Anhui KF743875
Diderma deplanatum MCCNNU00136 Zijin Mountain, Jiangsu KF743877 KF743864
Didymium iridis GenBank GU182126 AJ938149~
~AJ938151
Didymium minus MCCNNU00135 Zijin Mountain, Jiangsu KF743878 KF743865
Didymium nigripes MCCNNU00130 Kongdong Mountain, Gansu KF743866
GenBank AF239224 AF239230
Didymium squamulosum MCCNNU00131 Dawei Mountain, Yunnan KF743879 KF743867
GenBank JQ277928
GenBank AM231293
GenBank HE614613
Fuligo septica MCCNNU00056 Chuzhou, Anhui KF743880
GenBank AJ58446
Physarum bivalve MCCNNU00133 Kongdong Mountain, Gansu KF743869
Physarum melleum MCCNNU00137 Zijin Mountain, Jiangsu KF743882 KF743870
GenBnak KC759095~
~KC759096
Physarum polycephalum GenBank L14779 X13160
Stemonitida Stemonaria longa MCCNNU00169 Xunhua, Qinghai KF743871
Stemonitis flavogenita GenBank AF239222 HE614592
GenBank AF239229
Stemonitis fusca MCCNNU00019 Zijin Mountain, Jiangsu KF743883 KF743872
Stemonitopsis subcaespitosa MCCNNU00171 Tianmu Mountain, Zhejiang KF743884
while other genes should be used to clarify the relationships of the Class Myxogastria.
The cytochrome c oxidase subunit I gene (COI) appears to be the most conservative protein-coding genes in the mitochondrial genome, and it commonly been used in molecular phylogenetic or taxonomic studies [12—14]. COI has been proposed as the universal DNA barcode for animals [15], and it provides a practical means to differentiate among morphospecies of naked lobose amoeba [16]. However, GenBank contains COI for only six myxogastrian species (Table 1): Physarum polycephalum, Didymium iridis, Didymium nigripes, Stemonitis flavogenita, Arcyria cinerea, and Clastoderma debaryanum.
The purpose of this study was to identify additional COI and SSU rRNA gene resources for myxogastrian
species, and analyze the phylogenetic relationship of myxogastrian in ordinal-level.
MATERIALS AND METHODS
Sample collection. All myxogastrian specimens were obtained in the field and identified according to current morphological species concepts [5]. The specimens represented 13 species across four families in three orders (Liceida, Physarida, and Stemonitida). They were identified by the corresponding author and deposited in the Center ofMicrobial Cultures of Nanjing Normal University, Jiangsu Province, China (Table 1).
DNA extraction, PCR amplification, and sequencing. Total DNA was extracted and purified from specimens according to standard methods [9]. New primers were designed to be able to successfully amplify the frag-
Table 2. The primers used for amplification and sequencing in this study
Gene Primers Primer sequence (5'-3') Position* (Accession number) Annealing temperature, °C
COI SSU rRNA COMF COMR SF12 SP03r GCTCCTGATATGGCWTTTC GTATCATGRAAWGCATATCWARACC TCYTAAAGAYTAAGGGATGCATGYC TCCTCTAATTGTTACTCGAG 327(L14779) 1118(L14779) 33(X13160) 594(X13160) 51-54 52-55
* Position with reference to Physarum polycephalum (accession number in NCBI).
ment of COI (Table 2), based on a comparison among the partial/full-length COI sequences of six myxogas-trian species representing four orders available in GenBank (Table 1). The primers S2 [9] and SP03r [17] were unable to amplify the 5' fragment of SSU rRNA (~600 bp) for Lycogala epidendrum. Thus, a new upstream primer, SF12, was designed to work with SP03r [17] to amplify the same region ofSSU rRNA (~600 bp). All primers are listed in Table 2.
PCRs were performed in 25-^L reactions with 33 cycles, each including 60 s at 94°C, 60 s at 51-55°C (annealing temperature; see Table 2), and 90 s at 72°C. Cloning and sequencing were performed by the Invit-rogen Company, Shanghai, China. All sequences were edited manually using the software Bioedit 7.0.9, and screened using the National Center for Biotechnology Information's (NCBI) BLASTn function. Finally, all sequences were submitted to NCBI, with accession numbers listed in Table 1.
Phylogenetic analysis. As the fruiting bodies of Echinostelida are too small and few in number to enable collected, the species were collected only representing four orders ofMyxogastria in the present study. We also tried to amplify sequences from A. cinerea representing order Trichiida; however, their surfaces were contaminated by filamentous fungi so the resulting sequences were unusable for phylogenic analyses. Thus, the sequences of orders Echinostelida and Trichiida were available from GenBank. As there were only four SSU rRNA sequences of Echinostelida (Barbeyella minutissima, Echinostelium minutum, Echinostelium arboret
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.