ГЕНЕТИКА, 2014, том 50, № 10, с. 1188-1199
ГЕНЕТИКА ЖИВОТНЫХ =
УДК 575.2:636.3
GENETIC VARIATION OF 5 SNPs OF MC1R GENE IN CHINESE INDIGENOUS SHEEP BREEDS
© 2014 G. L. Yang1, *, D. L. Fu2* *, X. Lang3, Y. F. Yan1, and Y. Z. Luo2
1 Department of Life Sciences, Shangqiu Normal University, Shangqiu 476000, China e-mail:guangliyang@163.com, yanyf01@sina.com 2 Gansu Province Key Laboratory of Herbivorous Animal Biotechnology, Gansu Agricultural University, Lanzhou 730070, China e-mail:fudongli1987@163.com, luoyz@gsau.edu.cn 3 Lanzhou Institute of Animal and Veterinary Pharmaceutics Sciences;
Chinese Academy of Agricultural Sciences, Lanzhou 730050, China e-mail: langxiax@163.com Received November 29, 2013; in final form April 28, 2014
The purpose of this study was to assess genetic diversity, genetic differentiation relationship and population structure among 10 Chinese sheep populations using 5 single nucleotide polymorphisms (SNPs) in MC1R gene. The genetic diversity indices suggested that the intra-population variation levels of Chinese Merino and Large-tailed Han breeds were lowest than Kazakh Fat-Rumped. Chinese sheep breeds have maintained a high intra-population variation levels (95.23%). The genetic differentiation patterns and genetic relationships among Chinese sheep breeds displayed a high consistency with the traditional classification. The cluster trees were constructed by UPMGA method. The results showed that Chinese indigenous sheep populations have distinct genetic differentiation. The inter-population variation levels in Chinese sheep populations indicated three geographically independent domestication events have occurred. The Bayesian cluster analyses also showed a reliable clustering pattern, which revealed three major clusters in Chinese indigenous sheep populations (Mongolian group, Kazakh group and Tibetan group), except for Duolang and Minxian Black-fur. There were probably caused by different breeding history, geography isolation and different levels of inbreeding. The findings supported the related records in literature, ten sheep populations originated on different time stage from the primogenitor population and communicated genetically with each other in the process of natural and artificial selection, and in different ecological environment. It is concluded that Chinese indigenous sheep have higher genetic variation and diversity, genetic differentiation exist between Chinese sheep populations. The majority breeds are consistent with the geographical distribution and breed characteristic.
DOI: 10.7868/S0016675814100166
As one of the earliest livestock species, sheep (Ovis aries) are distributed in many countries, especially in China. It has been reported that there are 71 sheep breeds (42 indigenous, 21 cross, 8 introduced and some undocumented breeds) in China [1]. Because of complicated topography, great gaps in altitude, and long distances between hinterland and ocean, China has diversified ecological conditions and climate types (North Temperate Zone and Subtropical Zone), which have profoundly influenced the formation and distribution of domestic animal diversity [2]. In addition, during the long-term selective breeding, it has also resulted in diverse phenotypes in Chinese indigenous breeds, including black, white, brown pigment types. In most breeds, all sheep individual share the same color pattern as breed characteristic, such as Minxian Black-fur, Kazakh Fat-Rumped and Mongolian (Fig. 1).
Genetic studies in Chinese native sheep populations have been performed on mitochondrial DNA,
* These authors contributed equally to this work.
microsatellite DNA markers [3—7]. Despite having only begun, 10000 years ago, the process of domestication has resulted in a degree of phenotypic variation within individual species normally associated with much deeper evolutionary time scales. Though many variable traits found in domestic animals are result from recent human-mediated selection, uncertainty remains as to whether the modern ubiquity of longstanding variable traits such as coat color results from selection or drift, and whether the underlying alleles were present in the wild ancestor or appeared after domestication began [8].
Coat color in domestic animals is one of the most strikingly variable and visible traits, and has been widely used for a unique phenotype in the morphological selection that considered for breed identification and attribution. In a large number of mammalian species, the coat color diversity is mainly determined by the relative amount of two basic melanins, eumelanin (black/brown) and phaeomelanin (yellow/red) in which are genetically controlled by the Extension (E)
GENETIC VARIATION OF 5 SNPs OF MClR GENE Gansu Alpine Fine-wool Tan Minxian Black-fur
Kazakh Fat-Rumped
Tibetan
Fig. 1. Geographic distribution of 10 sheep populations in this study.
and Agouti (A) loci, respectively [9]. A notable example is the conserved role of the MClR in mammalian pigmentation [10]. Studies of MClR have provided valuable insights not only into the biology of pigmentation but also the evolution of domesticated animals [8, 11]. Morphological diversity within closely related species is an essential aspect of evolution and adaptation. The correspondence between coat color and habitat is often attributed to natural selection, but rarely is supporting evidence provided at the molecular level [12].
In this study, we have selected 10 Chinese sheep breeds, which have significant different phenotypic characteristics and geographic ranges. Five SNPs (c.218 T>A, c.361 G>A, c.429 C>T, c.600 T>G, c.735 C>T) of the MC1R gene were identified in Chinese sheep breeds and were used for assess genetic diversity, phylogenetic relationship, genetic differentiation and population structure among ten Chinese sheep populations. So as to obtain a broader understand genetic relationships among the population and their demographic history.
MATERIALS AND METHODS
A total of 373 blood samples were collected from 10 Chinese sheep breeds representing a range of distinct coat colors (Fig. 1). Breed name, sample size, coat
color phenotype and sampling location for each breed were shown in Table 1. Coat colors were determined by direct visual inspection. Genomic DNA was extracted from blood specimens by using the TIANamp blood DNA kit (Tiangen, Beijing, China).
SNPs or mutations were identified by sequencing amplicons of the whole coding region (CDS, 954 bp) and parts of the 5'- and 3'-untranslated regions (35 and 125 bp, respectively) of MClR in two directions. Three DNA pools comprise thirty individuals with 10 from each breed of Large-tailed Han sheep (White), Minxian Black-fur sheep (Black) and Kazakh fat-rumped sheep (Brown), and were used for identification mutation sites. Primers (MF: GAGAGCAAGCACCCTTTCCT MR: GAGAGTCCTGTGATTCCCCT) for MClR amplification and sequencing were designed with the program Primer 3 (http://fokker.wi.mit.edu/) based on the published sequences of coding region in sheep (GenBank accession number: Y13965) and the complete sequences in bovine and goat which include 5'-and 3'-untranslated flanking regions (GenBank accession number: AF445641, FM212940).
All amplifications were performed on Eppendorf Mastercycler (Hamburg, Germany). The amplification program consisted of 94°C for 3 min, 35 cycles of 94°C for 30 s, annealing temperature 62°C for 30 s and
Table 1. Sample collection: Breed name, sample size, coat color phenotype and sampling location
Breed Number Coat color phenotype Collection location
Minxian Black-fur 46 Black Gansu, Min county
Tibetan 42 White, with black or brown face Qinghai,Hainan county
Large-tailed Han 48 White Henan, Jia county
Small-tailed Han 34 White Shandong, Heze county
Mongolian 51 White, with black or brown face Mongolian
Tan 45 White, with black or brown face Gansu, Jintai county
Kazakh Fat-Rumped 18 Brown Xinjiang, Akesu
Gansu Alpine Fine-wool 34 White Gansu, Sunan county
China Merino 27 White Xinjiang, Yili state
Duolang 28 White or gray, with black or brown face Xinjiang, Maigaiti county
72°C for 30 s with a final extension step of 72°C for 10 min. The PCR products were separated by electrophoresis on 1.5% agarose gels and visualized by ethid-ium bromide staining. PCR products were purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and bi-directionally sequenced with the PCR primers. Sequences were analyzed using DNAStar software (DNAStar Inc., Madison, Wis, USA) to identify polymorphisms. Identified highly informative SNPs were chosen for genotyping by sequencing in a larger sample of animals belonging to the 10 breeds. PCR amplification and SNPs genotyping were performed as described above.
To assess within-population genetic diversity, the genetic variation for each population was estimated using POPGENE 3.1 software [13], including allele frequency, the mean effective of alleles (Ne), observed number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He) and Shannon's information index (I). Test for deviations from Hardy-Wein-berg equilibrium (HWE) between loci were also performed by POPGENE 3.1 [13]. The Ewens-Watter-son's tests for neutrality were performed the algorithm given in Manly (1985) with 10000 simulations across populations at a locus [14]. The haplotypes of 5 SNPs within the sheep MC1R gene were inferred using the PHASE program v. 2.1 [15]. We retained only those phases known with high probability (P > 1) for further analyses. Several parameters were estimated with DnaSP v. 4.10 [16], including Nucleotide diversity: Tajima's D (Tajima, 1989) and Fu's Fs statistic (Fu, 1997). Values of Tajima's D and Fu's Fs were also used as indication of a recent change in population sizes because they are sensitive to departures from demographic equilibrium.
For the investigation of phylogenetic relationships among populations, the standard genetic distance and genetic id
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.