научная статья по теме ГЕНЫ ЦЕЛЛЮЛОЗОСИНТАЗ, КОНТРОЛИРУЮЩИЕ ФОРМИРОВАНИЕ ВОЛОКНА ЛЬНА (LINUM USITATISSIMUM L.) Биология

Текст научной статьи на тему «ГЕНЫ ЦЕЛЛЮЛОЗОСИНТАЗ, КОНТРОЛИРУЮЩИЕ ФОРМИРОВАНИЕ ВОЛОКНА ЛЬНА (LINUM USITATISSIMUM L.)»

ГЕНЕТИКА, 2014, том 50, № 1, с. 26-34

ГЕНЕТИКА РАСТЕНИЙ

УДК 633.521:577.21

ГЕНЫ ЦЕЛЛЮЛОЗОСИНТАЗ, КОНТРОЛИРУЮЩИЕ ФОРМИРОВАНИЕ

ВОЛОКНА ЛЬНА (Linum usitatissimum L.)

© 2014 г. Д. В. Галиновский1, Н. В. Анисимова1, А. П. Райский2, В. Н. Леонтьев2,

В. В. Титок3, Л. В. Хотылева1

1Институт генетики и цитологии Национальной академии наук Беларуси, Минск 220072

e-mail: dimgal200@rambler.ru 2Белорусский государственный технологический университет, Минск 220006 3Центральный ботанический сад Национальной академии наук Беларуси, Минск 220012

Поступила в редакцию 23.04.2013 г.

На основании анализа класс-специфических областей идентифицированы четыре гена целлюлозо-синтаз (LusCesA1, LusCesA4, LusCesA7и LusCesA9), из которых на стадии быстрого роста растений льна LusCesA4, LusCesA7и LusCesA9экспрессируются в стебле, LusCesA1 и LusCesA4 — в апикальной части растений и LusCesA4 — в листьях. Показано, что экспрессия генов LusCesA7 и LusCesA9 специфична для стеблей льна-долгунца и, вероятно, влияет на качество льноволокна.

DOI: 10.7868/S0016675814010056

Для получения волокна лен выращивается человеком уже более 10 тыс. лет [1]. И в настоящее время льноволокно востребовано в текстильной промышленности, а также в производстве композитных материалов [2]. По сравнению с другими природными волокнами (шерсть, хлопок) лен обладает рядом преимуществ, важнейшие из которых — высокая механическая прочность и гигроскопичность. Эти свойства обусловлены особенностями структуры льноволокна, которое состоит из мельчайших трубочек с толстыми стенками, называемых элементарными волокнами. С биологической точки зрения элементарные волокна являются клетками флоэмы с гипертрофированной клеточной стенкой. По химическому составу основное вещество льноволокна — целлюлоза, которая определяет его физико-химические свойства и технологические характеристики. Содержание целлюлозы в зрелом волокне может достигать 70% его массы [3]. Изучение процессов биогенеза вторичной клеточной стенки, а в частности биосинтеза целлюлозы, у льна имеет не только фундаментальное, но и прикладное значение [4].

Молекулярные механизмы биосинтеза целлюлозы в настоящее время изучены недостаточно. Известно, что синтез целлюлозных цепей происходит в полиферментных комплексах, называемых целлюлозосинтазными розетками, которые у высших растений представлены в виде встроенных в мембрану шестиугольных структур [5]. Трансмембранная целлюлозосинтазная розетка образована 36 каталитическими субъединицами — целлюлозосинтазами, которые одновременно по-лимеризуют 36 р-(1 —4)-глюкановых цепей, формирующих микрофибриллу целлюлозы [6].

Сложность строения целлюлозосинтазного комплекса не позволяет in vitro воспроизвести этот биохимический процесс и добиться прямой демонстрации ферментативной реакции [7], что затрудняет изучение биосинтеза целлюлозы. До настоящего времени подходы молекулярной генетики остаются наиболее перспективными при изучении синтеза целлюлозы в высших растениях.

Целлюлозосинтазы кодируются CesA-генами, которые у высших растений принадлежат к муль-тигенному семейству. В геноме Arabidopsis thaliana (L.) Heynh. выявлено 10 генов целлюлозосинтаз [8], у тополя — 16 [9], у риса (Oryza sativa L.) — 13, у пшеницы (Triticum aestivum L.) >50 [10]. Установлены две группы генов целлюлозосинтаз, которые экспрессируются при формировании первичной и вторичной клеточных стенок [11], а также показана тканеспецифичная экспрессия различных представителей мультигенного семейства целлюлозосинтаз [12].

При изучении структуры различных CesA-генов стало ясно, что идентифицировать гены целлюло-зосинтаз можно не только по полноразмерной последовательности гена, но и по последовательности класс-специфической области (Class Specific Region (CSRII)), т.е. по последовательности фрагмента гена [13]. Такие области консервативны у CesA-орто-логов и могут быть использованы для идентификации представителей мультигенного семейства целлюлозосинтаз. Эффективность данного подхода была продемонстрирована на осине [14].

Наши работы направлены на изучение роли отдельных CesA-генов в процессе формирования льноволокна. Поскольку льняное волокно полу-

Таблица 1. Праймеры, использованные в работе

Праймер Нуклеотидная последовательность, 5' —- 3' Назначение Ссылка

F_A6_302 R_A6_302 ttattgctgtccagagagag agaaccatatactggcaaga Проверка синтезированной кДНК льна [16]

HVR2F HVR2R tgytatgtycagttyccwc ganccrtaratccaycc Амплификация СБКЛ-обласш [14]

M13/pUC sequencing primer (—20), 17-mer M13/pUC revers sequencing primer (—26), 17-mer gtaaaacgacggccagt caggaaacagctatgac Проверка наличия вставки в плазмиде рТ/57Я [18]

чают из стеблей льна-долгунца, мы предполагаем, что гены целлюлозосинтаз, функционирующие в данном растительном органе, контролируют образование льноволокна и влияют на его качественные характеристики. Цель данной работы — идентификация генов целлюлозосинтаз, специфически экспрессирующихся в стеблях растений льна-долгунца.

МАТЕРИАЛЫ И МЕТОДЫ

Объекты исследования. Объект исследования — сорт льна-долгунца Блакгт (Беларусь). Для анализа использовали стебли, листья и апикальную часть льна на стадии быстрого роста (41-е сутки со дня посева в открытом грунте).

При отборе растительного материала у растений удаляли корень, а надземную часть разделяли на апикальную часть выше "точки слома", стебель ниже "точки слома" и листья с участка стебля ниже "точки слома". Из отобранных проб массой ~100 мг по методике с использованием TRI REAGENT™ выделяли общую РНК [15]. Очистку РНК от ДНК проводили с помощью фермента ДНКаза1 (Fermentas, Литва), после чего препараты РНК растворяли в 100 мкл воды, не содержавшей РНКазы. Качество полученных препаратов контролировали спектрофотометрически.

ПЦР и методы клонирования. Для ферментативного синтеза кДНК посредством обратной транскрипции в качестве матрицы использовали аликвоту, содержавшую ~5 мкг РНК, очищенной от ДНК, а также праймеры Oligo(dT)18 и набор RevertAid H Minus First Stand cDNA Synthesis Kit (Fermentas). Для тестирования качества полученной кДНК проводили амплификацию с прайме-рами F_A6_302 / R_A6_302 (табл. 1).

Для амплификации CSRII использовали праймеры, предложенные Liang, Joshi (табл. 1) [14]. ПЦР проводили при следующих условиях: 4 мин при 95°C; далее 30 циклов: 60 с при 94°C, 90 с при 41°C и 120 c при 72°C, заключительный этап — 10 мин при 72°C. После проведения ПЦР

фрагмент переосаждали холодным 96%-ным этанолом.

Амплифицированные фрагменты клонировали в плазмидный вектор pTZ57R в бактерии E. coli XL1-Blue с использованием InsTAclone™ PCR Cloning Kit (Fermentas). Для отбора клонов, несущих вставку в составе вектора, бактерии высевали на плотную LB-среду, содержавшую 50 мкг/мл ампициллина, 0.002% 5-бромо-4-хлоро-3-индо-лил-р^-галактопиранозида и 0.1 мМ изопро-пил-1-тио-р^-галактопиранозида.

Проверку бактериальных трансформантов на присутствие в плазмиде целевых ПЦР-фрагмен-тов проводили с бактериальных колоний с прай-мерами к полилинкеру плазмиды pTZ57R (табл. 1) с помощью ПЦР при следующих условиях: 4 мин при 95°C; далее 25 циклов: 60 с при 94°C, 60 с при 51°C и 60 c при 72°C; заключительный этап — 10 мин при 72°C.

Последующее разделение продуктов ПЦР осуществляли с помощью электрофореза. В работе использовали метод горизонтального электрофореза в 1%-ном агарозном геле с использованием Tris-ацетатного буфера.

Секвенирование. В качестве матрицы для проведения секвенирующих реакций использовали плазмидную ДНК, которую очищали с помощью набора GeneJet™ Plasmid Miniprep Kit (Fermentas). Секвенирующие реакции проводили с использованием Big DyeTM Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems, США). Очистку продуктов реакции осуществляли путем переосаждения с 96%-ным этанолом и ЭДТА согласно рекомендациям фирмы-изготовителя, после чего продукты секвенирующей реакции осаждали, осадки высушивали и ресуспендировали в 10 мкл HiDi-формамида. Образцы денатурировали при 95°C в течение 2 мин и немедленно охлаждали на льду. Секвенирующий электрофорез проводили на ABI Prism™ 310 Genetic Analyzer (Applied Biosystems) при 11 300 В и 50°C с применением соответствующего программного обеспечения. Данные обрабатывали с использованием программного пакета Sequencing Analysis v5.3.0.

1000500-

750500-пн

Рис. 1. Электрофореграмма CSRII генов целлюлоза-синтаз апикальной части (1), листьев (2) и стебля (3) льна-долгунца. М1 — маркерные фрагменты (Gene-Ruler 100 bp DNA Ladder Plus, Fermentas), М2 - маркерные фрагменты (GeneRuler 1 kb DNA Ladder, Fermentas).

Биоинформатические методы. Анализ полученных нуклеотидных последовательностей проводили с помощью программ BLAST 2.2.18+ (http://www.ncbi.nlm.nih.gov/blast), ClustalX 1.83.

Для сопоставления CSRII генов целлюлозосинтаз льна-долгунца с их ортологами из генома A. thaliana (L.) Heynh. использовали последовательности генов целлюлозосинтаз A. thaliana, депонированные в GenBank: AtCesAl - NM_119393, AtCesA2 -NM_120095, AtCesA3 - NM_120599, AtCesA4 -NM_123770, AtCesA5 - NM_121024, AtCesA6 -NM_125870, AtCesA7 - NM_121748, AtCesA8 -NM_117994, AtCesA9 - NM_127746, AtCesAlO -NM_128111. Поиск CSRII в приведенных последовательностях генов осуществлялся с помощью вырожденных праймеров [14]. Выравнивание нуклеотидных последовательностей, расчет их идентичности (на основе попарного выравнивания) и построение филогенетического дерева (алгоритм Saitou and Nei) осуществляли с применением программы AlignX из пакета программ Vec-torNTISuite 7.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Молекулярное клонирование класс-специфических областей генов целлюлозосинтаз, функционирующих в разных частях растений льна-долгунца

Проводили исследование и идентификацию индивидуальных CesA-генов льна-долгунца, а также сравнительный анализ CesA-генов, экспресси-рующихся в стеблях, листьях и апикальной части растений. Гены целлюлозосинтаз идентифицировали методом, основанным на сравнении класс-специфических областей генов целлюлозосинтаз [14], который был адаптирован нами для льна. Данный метод базируется на особенностях строения целлюлозосинтаз растений. Вс

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»