ГЕНЕТИКА, 2014, том 50, № 1, с. 116-120
КРАТКИЕ СООБЩЕНИЯ
y%K 575.1:597.554.3
ISOLATION AND CHARACTERIZATION OF EIGHTEEN POLYMORPHIC MICROSATELLITE LOCI IN Schizopygopsis younghusbandi Regan AND CROSS-AMPLIFICATION IN THREE OTHER Schizothoracinae species
© 2014 S. S. Guoa,b, G. R. Zhanga b, X. Z. Guoa- b, K. J. Weia,b, W. Jia,b, and Q.W. Weic
a Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture, College of Fisheries, Huazhong Agricultural University, Wuhan, 430070 P.R. China
e-mail: kjwei@mail.hzau.edu.cn
b Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, Wuhan, 430070 P.R. China
c Key Laboratory of Freshwater Biodiversity Conservation, Ministry of Agriculture, Yangtze River Fisheries Research Institute,
Chinese Academy of Fishery Sciences, Wuhan, 430223 P.R. China
Received May 27, 2013
Eighteen polymorphic microsatellite loci were isolated from Schizopygopsis younghusbandi Regan and the characterization of these loci was assessed in 46 individuals collected from the Yarlung Tsangpo River in Tibet, China. The number of alleles per locus ranged from 2 to 14. The expected heterozygosity and ShannonWiener diversity index ranged from 0.022 to 0.879 and from 0.059 to 2.313, respectively. The cross-species amplification and applicability of these loci were tested in three other Schizothoracinae species belonging to Schizothorax and Oxygymnocypris. These loci will be useful for the evaluation of genetic diversity and population genetic structure in S. younghusbandi and other related species.
DOI: 10.7868/S0016675814010068
Schizopygopsis younghusbandi Regan 1905 (Cyp-rinidae: Schizothoracinae) is an endemic tetraploid fish that is mainly distributed in the middle reaches of the Yarlung Tsangpo River in Tibet, China [1, 2]. It is characterized by cold-adapted, low growth rate and late sexual maturity as adaptation to its rigorous environment. For the past few decades, S. younghusbandi has experienced a sharp decline in population size due to overfishing and environmental deterioration. To conserve natural resources of this species, it is especially necessary to assess its genetic diversity and population genetic structure. Little genetic characteristic of this species is available except for limited research on its chromosome, phylogeny and biology [2-5]. Microsatellites are highly informative molecular markers and widely used in population genetic studies [6]. In this study, 18 polymorphic microsatellite loci were isolated and characterized in S. younghusbandi and cross-amplification utility of these markers were tested in three additional Schizothoracinae fishes in order to provide a useful tool for the evaluation of genetic diversity and population genetic structure in the near future.
Specimens of S. younghusbandi (n = 46), Schizothorax waltoni (n = 10), Schizothoraxmacropogon (n = 10) and Oxygymnocypris stewartii (n = 10) were collected from Xaitongmoin section of the Yarlung Tsangpo River in Shigatse, Tibet. Genomic DNA was extracted
from pectoral fin tissue using phenol-chloroform method. (AC)n-microsatellite enriched library was conducted using the fast isolation by AFLP of sequences containing repeats (FIASCO) method [7] with little modification [8]. Genomic DNA of S. younghusbandi was digested with Msel (Fermentas, EU). Digested DNA fragments were purified and ligated to MseI adaptor (5'-TAGTCAGGACTCAT-3'/5'-GACGATGAGTCCTGAC-3') at 16°C overnight using T4 DNA ligase (Takara, China). The ligated products were amplified with MseI-N (5'-AT-GAGTCCTGACTACN-3') as primers using polymerase chain reaction (PCR). 500 ng of PCR products were hybridized with 5'-biotinylated (AC)10 probes. Probe-bound DNA fragments were then enriched by streptavidin-coated magnetic beads (Promega, USA). Captured DNA fragments containing microsatellites were amplified with primers MseI-N. Then the purified PCR products were ligated to pMD18-T vector (Takara, China) following the manufacturer's instruction and transformed into Escherichia coli DH5a competent cells. A total of 57 clones were sequenced by Sangon Biotech Company (Shanghai) using an ABI PRISM 3730 sequencer (Applied Biosystems). Fifty-one of the sequenced clones contained microsatellite repeats. Twenty-five pairs of primers were designed using Primer Premier 5.0 [9].
Table 1. Characterization of 18 microsatellite loci for Schizopygopsis younghusbandi
о -t.
Locus Accession no. Repeat motif Primer sequence (5'-3') Ta(° C) Size (bp) HE H' PIC
LLKOl KC431889 (TG)g F: AAAGCGAGTGGGAACATTGGAT R: AGCACAGGTGAGAGAGGGGC 56 190- -240 5 0.740 1.429 0.677
LLK02 KC431890 (CA)46 F: ACAGATGAGATTCACTGACACA R: CCACCAAGTTTTCACCCT 55 200- -298 10 0.870 2.141 0.863
LLK03 KC431891 (GT)10...(TG)15 F: ATATACAGCAAGGTTTGGCTCA R: AAAGGTCTGGAAAGTTTGGAAG 58 193- -284 11 0.864 2.142 0.828
LLK04 KC431892 (CT)5(TG)13 F: CAGATGGAGGAAGACGAGA R: TTAGCATGACACAAGGAACT 50 168 -179 3 0.283 0.537 0.146
LLK05 KC431893 (CA)32 F: GTGTCGGACGGAGGTCAGATA R: AGAGATGCAAGCAACAAACGC 54 235- -324 10 0.733 1.699 0.695
LLK06 KC431894 (TG)16 F: GTCTATTGCTTTCATTGCCCT R: TGTTCTTGTTCAGCCCATTAC 50 142- -148 2 0.022 0.059 0.011
LLK07 KC431895 (AC)10 F: ATGTCATTTGGGGGCAAGTTA R: CGATGTGTATTCCCGTGAGACT 54 104- -150 9 0.866 2.085 0.843
LLK08 KC431896 (GA)7...(TG)24 F: GACAGCAGACATAATAACGCA R: CCATAAATCACCTTCTCCTTG 55 252- -340 10 0.846 2.085 0.785
LLK09 KC431897 (CA)9CG(CA)5 F: AGCCTGAAAGAGGAACGGAGT R: ACAACAGAACAGCAACGCATT 61 277- -343 9 0.841 1.951 0.816
LLK10 KC431898 (TG)37 F: CCAGTTTAGGCCAGGAATGG R: GGAAGGGCAGCGATGATGT 61 173- -263 11 0.854 2.044 0.832
Table 1. (Contd.)
Locus Accession no. Repeat motif Primer sequence (5'-3') Ta(° C) Size (bp) HE H' PIC
LLK11 KC431899 (AC)13 F: AGGGAGAALAAGALGGLG R: LGLAAACAGCLCGACLGA 54 157-191 1 0.816 1.784 0.776
LLK12 KC431900 (CA)9 F: AGGGLGALGAGALGLGGL R: AGLCAACLALGALGGACGA 54 129-186 10 0.867 2.117 0.848
LLK13 KC431901 (GL)20 F: CLLLLALLAGCCALCLGACCLG R: AGACACGCCALLALGLGACLAL 49 165-236 10 0.869 2.119 0.853
LLK14 KC431902 (AC)22 F: CACLLALCGCALLLALCCA R: GCLCLLAALCCAGGGCLAL 52 211-345 14 0.879 2.313 0.867
LLK15 KC431903 (GL)22 F: GCCALLAGAALCAGAGCG R: ALLGGAGAALACAAACAGGLG 54 107-159 10 0.859 2.093 0.840
LLK16 KC431904 (AC) u F: AGLGLALGLLLLLALGGCGGC R: CCLCLCLGLGGCLLCLGGACL 58 100-126 6 0.725 1.509 0.629
LLK17 KC431905 (GL)i3 F: GLAAAGLLLLGCGLGAGLGC R: AGLCALGGACAAGLGLGCCL 58 255-300 7 0.819 1.825 0.784
LLK18 KC431906 (LG)i2 F: GCAAGAGGALACLLLLCA R: ALCLGALAGAAGGGCLGL 52 179-212 6 0.670 1.386 0.598
Ta, annealing temperature; Size, allele size range; NA, number of alleles; H^, expected heterozygosity; H', Shannon—Wiener diversity index; PIC, polymorphism information content.
ISOLATION AND CHARACTERIZATION OF EIGHTEEN POLYMORPHIC
Table 2. Cross-amplification of 18 microsatellite loci in three other Schizothoracinae species
119
Schizothorax waltoni Schizothorax macropogon Oxygymnocypris stewartii
Locus (n = 10) (n = 10) (n = 10)
Size range (bp) Na Size range (bp) Na Size range (bp) Na
LLK01 171-223 4 171-223 4 214-273 4
LLK02 253 1 - - 231-282 8
LLK03 - - - - 178-205 4
LLK04 - - - - 155-164 2
LLK05 218-275 5 224-262 2 257-321 6
LLK06 - - - - - -
LLK07 97 1 95-108 3 104-127 4
LLK08 — - - - 268-310 5
LLK09 - - - - 282-375 6
LLK10 172-190 2 170-193 5 188-228 6
LLK11 - - - - 160-175 2
LLK12 - - - - 133-147 2
LLK13 - - - - 183-204 4
LLK14 100 1 100 1 188-264 8
LLK15 - - - - 114 1
LLK16 - - - - 107-111 2
LLK17 - - - - 262-331 8
LLK18 153-171 3 153-165 2 92-116 2
Note: n, number of samples trialed for each species; Na, number of alleles.
Each primer pair was screened for reliable amplification using 46 individuals of S. younghusbandi. The PCR amplification was carried out in a final volume of 10 |L including 1x Taq DNA polymerase buffer (Fermentas, EU), 0.5 |M of each primer, 1.5 mM of MgCl2, 0.5 U of Taq DNA polymerase (Fermentas, EU), 200 |M of each dNTP, and 40 ng of genomic DNA. PCR thermal conditions were as follows: an initial denaturation at 94°C for 4 min, followed by 28 cycles of 94°C for 30 s, locus-specific annealing temperature (see Table 1) for 30 s, 72°C for 45 s, and a final extension at 72°C for 10 min. The PCR products were separated on 8% non-denaturing polyacrylamide gel and visualized by silver staining. A 50 bp DNA ladder (Takara, China) was used as a standard to identify allele size. Additionally, cross-species amplification was investigated in three other Schizothoracinae species using the same PCR conditions as described above.
The number of alleles, expected heterozygosity and Shannon—Wiener diversity index were estimated using ATETRA 1.2 [10], which was developed to analyze microsatellite data for tetraploid species. The polymorphic information content (PIC) was calculated using the formula, PIC = 1 - ! (p2) - ; , +! (iptf), where pi and pj are frequencies of the i and j alleles respectively [11].
Eighteen out of 25 primer pairs designed were tested to be polymorphic in 46 individuals of S. younghusbandi. The ratio ofverified polymorphic loci was 72% in this study, which was higher than that of Schizothorax
biddulphi (58%) sequenced by Ion Torrent PGMTM [12]. The characteristics of 18 polymorphic loci for S. younghusbandi were described in Table 1. Up to four alleles were found in S. younghusbandi individuals, confirming the polyploidy of this species previously reported [2]. The number of alleles (NA) per locus ranged from 2 to 14 (average 8.33) with a total of 108 alleles. The expected heterozygosity (HE) ranged from 0.022 to 0.879 with an average of 0.746. The Shannon-Wiener diversity index (H') ranged from 0.059 to 2.313 with an average of1.740. The level of population genetic diversity in S. younghusbandi (HE = 0.746, Na = 8.33) was higher than that in S. biddulphi (HE = = 0.598, Na = 3.50) [12]. The polymorphic information content (PIC) per locus varied from 0.011 to 0.867 with an average of 0.705, suggesting that 16 loci were highly polymorphic exce
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.