научная статья по теме МЕЖВИДОВАЯ ГИБРИДИЗАЦИЯ В ПРОИСХОЖДЕНИИ ВИДОВ РАСТЕНИЙ НА ПРИМЕРЕ РОДА POA SENSU LATO Биология

Текст научной статьи на тему «МЕЖВИДОВАЯ ГИБРИДИЗАЦИЯ В ПРОИСХОЖДЕНИИ ВИДОВ РАСТЕНИЙ НА ПРИМЕРЕ РОДА POA SENSU LATO»

УСПЕХИ СОВРЕМЕННОЙ БИОЛОГИИ, 2015, том 135, № 1, с. 21-39

УДК 575.17:582.52

МЕЖВИДОВАЯ ГИБРИДИЗАЦИЯ В ПРОИСХОЖДЕНИИ ВИДОВ РАСТЕНИЙ НА ПРИМЕРЕ РОДА POA SENSU LATO

© 2015 г. Н. Н. Носов1, Е. О. Пунина1, Э. М. Мачс1, А. В. Родионов12

1Ботанический институт им. В.Л. Комарова РАН, Санкт-Петербург 2Санкт-Петербургский государственный университет E-mail: avrodionov@mail.ru

Сравнительное исследование ITS-последовательностей генома ядра и некоторых хлоропластных последовательностей злаков из рода Poa позволило выявить несколько видов Poa, возникших как результат межсекционной, а в некоторых случаях межродовой (между видами Poa и видами под-трибы Puccinelliinae) гибридизации. Установлено также филогенетическое положение для новых гибридов, найденных на Алтае, и для видов, неясных с точки зрения систематики.

Ключевые слова: межвидовая гибридизация, Poaceae, молекулярная филогения, Poa, злаки, Алтай, Китай, Северный Кавказ, Южная Сибирь, полиплоидия, сетчатая эволюция.

ВВЕДЕНИЕ

Семейство Злаки (Роасеае ВагпИаг!;) - удобный модельный объект для изучения явления межвидовой гибридизации и сопровождающего его акта полиплоидизации. Уже в ранней эволюционной истории семейства у общего предка всех злаков в результате акта полиплоидизации произошло увеличение числа хромосом в геноме с х = 5 до х = 10 и затем до х = 12. Позднее у всех, или почти у всех, злаков имело место еще одно удвоение всего генома (Ра;егеоп е; а1., 2012). Есть все основания предполагать, что межвидовая и даже межродовая гибридизации широко распространены и среди современных видов семейства и, в частности, в роде Роа Ь., большинство видов которого - аллополиплоиды (Цвелёв, 1976; Боге^, 2007; Родионов и др., 2007, 2010, 2013). Есть даже мнение, что весь род мятликов (или его европейские виды) представляет собой единый полиплоидный комплекс ^еЪЫш, 1950; Олонова, 2001). Не приходится сомневаться, что полиплоидия и межвидовая гибридизация создают новые генотипы и фенотипы, наиболее подходящие для колонизации новых и/или экстремальных местообитаний (Цвелёв, 2000; Родионов, 2013). Как следствие, наибольший процент аллополиплоидов встречается в высоких широтах и высокогорьях, а также на морских побережьях (Пробатова, 2007). Гибридизация между двумя высокоспециализированными видами ведет к вторичной деспециализа-ции, повышающей экологическую пластичность

(Цвелёв, 2000). Впрочем, природные межсекционные гибриды в роде Poa описываются нечасто. В некоторой мере это объясняется возвратными скрещиваниями и интрогрессией, когда в гибридном виде из-за постоянного скрещивания с одним из родительских таксонов преобладают черты лишь одной секции, что скрывает от исследователя акт предшествующей гибридизации.

Первую систему мятликов, в которой была указана важность гибридизации для филогении рода, представил Наннфельдт (Nannfeldt, 1941). Он причислял секции Subbulbosae (сейчас Alpinae), Stoloniferae (сейчас Poa), Abbreviatae, Homalopoa, Oreinos к "естественной единице, внутри которой известны межсекционные гибриды". Автор делает вывод, что только апомиктические и морфологически постоянные биотипы могут быть "хорошими" видами. Н.С. Пробатова (1970) предполагала гибридное происхождение секции Poa: возможно, объединенные в ней виды возникли путем гибридизации видов секций Triviales и Homalopoa. Секцию Ochlopoa, к которой принадлежит однолетник P. annua L., Н.С. Пробатова (1970) считала переходной к родам Colpodium Trin., Puccinellia Pari. и Phippsia (Trin.) R.Br., и, таким образом, представляя их родственными Ochlopoa. Очень существенной предполагалась роль гибридизации как источника перспективных линий развития у мятликов секций Poa и Stenopoa: предполагаемые межсекционные гибриды видов этих секций были выделены в качестве самостоятельной секции Poastena Probat. (Пробатова, 2006).

Последние молекулярно-филогенетические данные подтверждают некоторые из прежних гипотез. Например, показано, что культивары P. pratensis из США содержат последовательности из пяти субгеномов, родственных геномам нескольких секций мятликов - Stenopoa, Homalopoa, Secundae (Patterson et al., 2005). По результатам мультигенного анализа австралийские мятлики, принадлежащие к морфологически цельной группе, являются аллополиплоидами. Геном их гипотетического прародителя присутствует в геномах южноамериканского вида P. iridifolia (sect. Dioicopoa), североамериканского вида P. arachnifera (sect. Dioicopoa), P. nervosa (sect. Homalopoa), P. fendleriana (sect. Madropoa) и в геноме арктического циркумполярного P. arctica (sect. Malacanthae) (Griffin et al., 2011).

Эффективным способом исследования межродовой гибридизации оказались методы сравнительного анализа последовательностей ядерного генома и генома хлоропластов. Как правило, хлоропластные геномы наследуются по материнской линии (при межродовой гибридизации не всегда) (см. Трубачеева и др., 2012), в то время как ITS-по следовательно сти гибрид получает от обоих родителей и, по прошествии нескольких поколений, у него остаются преимущественно ITS одного предка - со стороны отца или со стороны матери (Kovarik et al., 2005). В ряде случаев это обстоятельство помогает выявить гибридное происхождение таксона и определить круг его родства как со стороны отца, так и со стороны матери. Показано, что род Arctopoa, рассматриваемый ранее (Цвелёв, 1976) как подрод рода Poa, в действительности представляет собой межродовой гибрид (Родионов и др., 2008, 2010; Носов, Родионов, 2008, Gillespie et al., 2008; 2010; Soreng et al., 2010). В результате межродовой гибридизации возникли рода Nicoraepoa и Aniselytron (Gillespie et al., 2010). Изучение происхождения аллополиплоидных геномов мятликов показало, что P. abbreviata, P. annua и P. trivialis располагаются неконгруэнтно на филогенетических деревьях, построенных при сравнении хлоро-пластных и ядерных (ITS) последовательностей ДНК (Soreng et al., 2010), а высокополиплоидные мятлики Новой Зеландии P. cita (2n = 84, ок. 96-100), P. chathamica (2n = 112) и P. litorosa (2n ~ 265) несут ядерный геном, родственный геномам евразиатских диплоидных (2n = 14) видов: P. remota (sect. Poa), P. chaixii (sect. Homalopoa), P. densa (sect. Bolbophorum) и P. sibirica (sect. Macropoa) (Родионов и др., 2010). Ядерный геном полиплоидных представителей секций Stenopoa, Tichopoa, Oreinos и Secundae оказался родстве-

нен геному диплоидного арктического вида P. pseudoabbreviata (sect. Abbreviatae). Наоборот, судя по генам 35SpРНК, геномы диплоидов P. trivialis (sect. Pandemos) и P. аnnua, P. supina (оба sect. Ochlopoa) лишь отдаленно родственны геномам высокополиплоидных видов (Родионов и др., 2010). Результаты анализа ДНК подтвердили гипотезу Наннфельдта (Nannfeldt, 1935) и Тутина (Tutin, 1957) о том, что P. annua - сегментный аллополиплоид с цитоплазмой, близкой к цитоплазме P. infirma (Soreng et al., 2010; Mao, Huff, 2012).

Цель данной работы - установить роль межвидовой гибридизации в таксонообразовании у представителей флоры Северного Кавказа, Алтая, Дальнего Востока, Китая и Российской Арктики на примере рода Poa. Для этого использовались последовательности ITS1-5.8S рДНК-Г^2 ядерного генома, интрон и межгенный спейсер районов trnT-trnL и trnL-trnF хлоропластного генома. Обнаруженные несоответствия в топологии филогенетических деревьев, полученных по разным наборам данных, свидетельствовали о сетчатой эволюции, характерной для мятликов, что позволило определить круг родства гибридогенных видов с материнской и отцовской стороны.

МАТЕРИАЛЫ И МЕТОДЫ

Материалом для исследования послужили образцы растений, как собранные авторами в природе, так и взятые из гербарных коллекций. В табл. 1 указаны происхождение каждого образца и его номер в Genebank (http://www.ncbi.nlm. nih.gov/ nucleotide). Выделение ДНК осуществляли модифицированным CTAB-методом (Doyle, Doyle, 1987; Родионов и др., 2005; Ким и др., 2009). Амплификация района ITS1-5.8S рДНК-ITS2 проводилась с прямого праймера ITS 1P aaccttatcatttagaggaagg (Ridgway et al., 2003) и обратного праймера ITS 4 tcctccgcttattgatatgc (White et al., 1990). Параметры реакции - 1 цикл: 5 мин 95 ОС; 30 циклов: 1 мин 94ОС, 1 мин 52 ОС, 1 мин 72 ОС; 1 цикл: 10 мин 72 ОС. Для амлификации последовательности межгенного спейсера trnT-trnL, интрона trnL и спейсера trnL-trnF использовались праймеры a, b, c, d, e, f (Taberlet et al., 1991). Параметры реакции - 1 цикл: 5 мин 95 ОС; 35 циклов: 1 мин 95 ОС, 1 мин 10 с 55 ОС, 1 мин 10 с 72 ОС; 1 цикл: 10 мин 72 ос.

Секвенирование было выполнено по стандартному протоколу, поставляемому с набором реактивов BigDye™ Terminator Kit vers. 3.1 ("Applied Biosystems", США) на секвенаторе

Таблица 1. Происхождение исследованных образцов Poa и близких родов

Название вида Номер последовательности в GenBank Номер ваучера и происхождение образца

ITS trnT-trnL / trnL-trnF

Arctopoa eminens (C. Presl) Pro- EU917442 KJ539170 № 994; РФ: Хабаровский кр., Де-Кастри

batova

Arctopoa schischkinii (Tzvelev) EU935583 Alt 55; РФ: Алтай, Кош-Агачский р-н, ур. Ак-

Probatova тал, берег р. Юстыт

Arctopoa sp. KJ416945 KJ539165 Ти80; РФ: Тува, Монгун-Тайгинский р-н,

KJ539166 р. Моген-Бурен

Arctopoa tibetica (Munro ex Stapf) JF786332 Ти66; РФ: Тува, Монгун-Тайгинский р-н, берег

Probatova р. Моген-Бурен, в воде у моста

Catabrosa minor (Bab.) Tzvelev EF577510 KS21; РФ: Мурманская обл., пос. Дальние

Зеленцы

Catabrosa sp. 1 FJ196299 Alt 311; РФ: Алтай, Кош-Агачский р-н, р. Чуя

Catabrosa sp. 1 KJ539178 Alt 10-113; РФ: Респ. Алтай, Кош-Агачский

р-н, р. Юстыт

Catabrosa sp. 2 KJ434110 KJ539169 Alt 11-73; РФ: Алтай, Кош-Агачский р-н,

оз. Малые Богуты

Catabrosella araratica (Lipsky) FJ196300 R43; Армения, Гегаркуникский р-н, 2300 м

Tzvelev н.у.м.

Catabrosella subornata E.B. Ale- FJ013225 TZ 002; Азербайджан, Талыш-Муганская АО,

xeev Талышские горы, каменистый склон, выс.

700-800 м н.у.м.

Catabrosella variegata (Boiss.) AY862811 T100; РФ: Карачаево-Черкесия, Тебердинский

Tzvelev зап.

Cinna latifolia (Trev.) Griseb. FJ026731 Alt 1083; РФ: Алта

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»