ПРИКЛАДНАЯ БИОХИМИЯ И МИКРОБИОЛОГИЯ, 2014, том 50, № 2, с. 163-170
UDC 577
OVEREXPRESSION AND CHARACTERIZATION OF LACCASE FROM Trametes versicolor IN Pichia pastoris
© 2014 Q. Li*, ***, J. Pei*, ***, L. Zhao*, ***, J. Xie*, F. Cao**, G. Wang **
*College of Chemical Engineering, Nanjing Forestry University, Nanjing 210037, China;
** College of Forest Resource & Environment, Nanjing Forestry University, Nanjing 210037, China;
***Jiangsu Key Laboratory of Biomass Based Green Fuels and Chemicals, Nanjing 210037, China
e-mail: lgzhao@njfu.edu.cn Received April 17, 2013
A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists of a 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50°C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0—7.0. The Km and the Vmax value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively.
DOI: 10.7868/S0555109914020123
Thus, this report provides an industrial means to produce the recombinant laccase in P. pastoris.
Laccases (benzenediol: oxygen oxidoreductase, EC 1.10.3.2) are multicopper phenoloxidases that catalyze the oxidation of a variety of phenolic compounds, with concomitant reduction of O2 to H2O. They belong to the family of blue multicopper proteins [1], which catalyzing the oxidation of phenolic and nonphenolic compounds including industrial dyes, aromatic amines and pesticides [2]. Due to the broad substrate spectrum of catalyzed reactions, they are considered to be industrially relevant enzymes for a variety of applications, including bioremediation of soils and water, playing a critical role in breaking down the tightly bound aromatic building blocks of lignocel-lulose and pulp biobleaching [3—5]. The industrial application of laccase requires high amount of low-priced enzyme.
Laccases are widely distributed among fungi such as Pleurotus ostreatus, Melanocarpus albomyces, Trametes versicolor and Aeromonas hydrophila [6—7]. Currently, laccases are also found to be widespread among bacteria, and actual laccase activity has been found in Escherichia coli, Bacillus subtilis, Bacillus halodurans, Thermus thermophilus and several streptomycetes [8— 10]. However, the production of laccase from parent strains obtained by the optimization of culture medium and cultivation conditions does not meet modern-
day demands of industry. For the production of the recombinant protein, the genetic engineering is the first choice because it is easy, fast, and cheap [11, 12]. In the past decade, the yeast Pichia pastoris has become a common system for the expression of heterologous proteins. Several factors have made this yeast a preferred tool in protein expression: the strong and highly regulated alcohol oxidase promoter, very stable integration events in host chromosomal DNA, efficient techniques for high-cell density cultivation and the commercial availability of strains and vectors. For any heterologous protein, expression conditions need to be optimized in order to achieve high levels of protein production. An earlier study of laccase expression in P. pastroris and Saccharomyces cerevisiae demonstrated the importance of pH and temperature on the level of laccase expression [13, 14]. The importance of copper ions for the laccase activity produced by T. versicolor has been demonstrated. The copper ions did influence the activity of the laccase with proportional concentration of copper in the growth medium [15].
The aim of the study was to make the molecular cloning and sequence analysis of the lccA gene from T. versicolor, to perform its expression in Pichia pastoris X33, to find the optimal fermentation conditions for laccase production in shake flask and large scale cultivation and to purify the enzyme by ultrafiltration and ammonium sulfate precipitation. The biochemi-
cal characteristics of the recombinant laccase have been studied extensively.
MATERIALS AND METHODS
Fungal strains, plasmids, and growth media. The
white-rot fungus Trametes versicolor was preserved by Jiangsu key laboratory of biomass based green fuels and chemicals, Nanjing, (China) which were screened from purple mountain of Nanjing. Escherichia coli TOPIOF, P. pastoris X33 and expression vector pPICZaB were purchased from Invitrogen (USA). The clone vector pMD19-T restriction endonucleases EcoRI, Xbal, T4DNA ligase, Ex-Taq DNA polymerase were obtained from Takara Biotechnology (China). pPICZaB — lccA plasmid was constructed by microbial technology research laboratory (Nanjing, China). E. coli was cultured in Luria-Bertani (LB) medium supplemented with 100 ^g/ml zeocin. The media for P. pastoris as BMGY, BMMY, YPD and YPDS were made according to Invitrogen operation manual. ABTS and CuSO4 were added to MM plates (2% peptone and 1% yeast extract) to prepare MM + 0.2 mM ABTS + 0.3 mM CuSO4 plates.
T. versicolor was grown at 28 °C in Kirk salts medium (g/L): K2PO4 - 20; MgSO4 ■ 7H2O - 5; CaCl2 -1.3; thiamine — 0.1 and Kirk trace elements (100 mL/L). Kirk trace elements [16] (6x) contained (g/L): N(CH2COOH)3 - 9.0; CoSO4 • 7H2O - 1.1;
1.1; CuSO4 • 5H2O - 0.06;
ZnSO4 • 7H2O -
AlK(SO4)
12H2O -
0.11;
H3BO3 - 0.06;
MnSO4 • 5H2O - 4.3; FeSO4 • 7H2O - 0.6; NaCl -6.0; Na2MoO4 • 2H2O - 0.072; MgSO4 • 7H2O - 18.0; CaCl2 • 2H2O - 0.6 (pH 4.5).
RNA and DNA manipulation. Qiagen plasmid kit and PCR purification kit (Qiagen, USA) were employed for the purification of plasmids and PCR products. RNA Prime Script RT reagent Kit and the DNA restriction and modification enzymes were purchased from TaKaRa (China). DNA transformation was performed by elec-troporation using GenePulser (Bio-Rad, USA).
Cloning of laccase gene lccA. Total RNA was isolated from a culture of T. versicolor by the method of Gromroff et al. [17]. PCR primers for cDNA amplification of lccA were designed based on the sequence of lac2 (GenBank Accession No.212732). The first strand cDNA synthesized from total RNA using Pri-meScript RT reagent Kit PCR was carried out using exTaq DNA polymerase, and the cDNA was used as the template. The 1.5 kb PCR product of lccA was cloned into pMD19-T vector and sequenced. All the primers were showed as follows:
lccF: GGGATGGGTCTGCAGCGATTCAGCTT;
lccR: GGGTCACTGGTTAGCCTCGCTCAGCC;
lccA_pPICZaBF: GGGGAATTCATGGGTCTGCAGCGATT;
lccA_pPICZaBR: GGGTCTAGATCACTGGTTAGCCTCGCTCA
Expression of laccase gene from T. versicolor in P. pastoris X33. PCR product lccA was digested with EcoRI and XbaI, ligated with the digested expression vector pPICZB and pPICZaB. The recombinant plasmid pPICZB-lccA and pPICZaB-lccA, constructed by our laboratory, were linearized with SacI and transformed into the recombinant P. pastoris X33 carrying pPICZB-lccA and pPICZaB-lccA competent cells (recombinant strain lccA) which had been constructed and expressed the laccase using a gene pulser XcellTM electroporation system (Bio-Rad, USA) at 2000 V and 5.1 ms according to the Pichia expression vectors manual (Invitrogen). The multicopy recombinant P. pastoris strains were screened and identified on YPDS plate containing zeocin (100 ^g/mL) at 28°C for 3-4 days. The transformants were screened for the production of laccase by transferring the colonies on MM plates containing 0.3 mM CuSO4 and 0.2 mM 2,2'-azino-bis(3-ethylbenzothia-zoline-6-sulfonic acid) (ABTS). Laccase-producing transformants were identified by the presence of a dark green color around the Pichia colonies.
Optimization for high-level expression of laccase.
The recombinant strain P. pastoris X33 was incubated in 30 mL ofBMGY medium containing (%): peptone - 2, yeast extract - 1, biotin - 0.02, glycerol - 1, yeast nitrogen base - 1, in 100 mM phosphate buffer (pH 6.0) for 24 h at 28°C with constant shaking at 180 rpm. When OD600 reached values between 3.0 and 8.0, the cultures were harvested, resuspended in 30 mL of BMGY containing 0.3 mM Cu2+ with the initial pH 6.0 and incubated in the same conditions until an OD600 of 1.0 was reached. 100% methanol was added daily (final concentration 0.5% (v/v)) to maintain induction. The samples were centrifuged at 8.000 x g for 5 min. The supernatant was stored at 4°C until used to determine enzyme activity.
Maintaining all factors at constant levels, except for the one being studied, the culture medium and cultivation conditions of the recombinant strain P. pastoris X33 were optimized for laccase production. The expression at different initial pH (ranging from 3.0 to 8.0) was tested. Induction was continued with the addition of methanol to final concentrations ranging from 0.4 to 1.2% (v/v) every 24 h to sustain the expression. The effect of peptone (2, 4 or 6%) and the different concentrations of Cu2+ (0.1, 0.3, 0.5 or 0.7 mM) on expression of laccase were studied. The liquid medium volume was changed from 30 to 70 mL (every 10 mL). The inocula were added into the BMGY medium shaking culture at 28°C until the OD600 reached 0.5, 0.8, 1.0, 1.2, or 1.5.
Purification of recombinant laccase. The supernatant (200 mL) was h
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.