научная статья по теме PURE MITOCHONDRIAL DNA DOES NOT ACTIVATE HUMAN NEUTROPHILS IN VITRO Химия

Текст научной статьи на тему «PURE MITOCHONDRIAL DNA DOES NOT ACTIVATE HUMAN NEUTROPHILS IN VITRO»

БИОХИМИЯ, 2015, том 80, вып. 5, с. 746 - 753

УДК 571.27

ОЧИЩЕННАЯ МИТОХОНДРИАЛЬНАЯ ДНК НЕ СПОСОБНА АКТИВИРОВАТЬ НЕЙТРОФИЛЫ ЧЕЛОВЕКА in vitro

© 2015 А.С. Приходько1, А.К. Шабанов2, Л.А. Зиновкина1, Е.Н. Попова3, М.А. Азнаурян1, Н.О. Ланина1, М.В. Витушкина4, Р.А. Зиновкин3,4*

1 Московский государственный университет им. М.В. Ломоносова, факультет биоинженерии и биоинформатики, 119991 Москва 2 Институт скорой помощи им. Н.В. Склифосовского, 129010 Москва

3 Московский государственный университет им. М.В. Ломоносова, НИИ физико-химической биологии им. А.Н. Белозерского, 119991 Москва

4 Московский государственный университет им. М.В. Ломоносова, биологический факультет, 119991 Москва; факс: +7(495)939-0338,

электронная почта: roman.zinovkin@gmail.com

Поступила в редакцию 22.12.14 После доработки 22.01.15

Чрезмерная активация врожденного иммунитета зачастую приводит к фатальным последствиям и может рассматриваться как один из вариантов феноптоза. При тяжелых травмах в кровоток попадают различные компоненты митохондрий, которые могут стимулировать миелоидные клетки врожденного иммунитета. Одним из таких стимуляторов предположительно может выступать митохондриальная ДНК (мтДНК) [1]. В настоящей работе была исследована роль мтДНК как непосредственного активатора нейтрофилов человека, а также как прогностического маркера у больных с тяжелой травмой. Количественное определение концентрации мтДНК в плазме больных с тяжелой травмой показало ее статистически значимое (р < 0,02) повышение у группы не выживших пациентов по сравнению с выжившими. В то же время высокоочищенные препараты мтДНК оказались не способны вызывать активацию нейтрофилов человека, что может указывать на существование дополнительных факторов, обеспечивающих узнавание мтДНК как «образа опасности».

КЛЮЧЕВЫЕ СЛОВА: травма, внеклеточная ДНК, митохондриальная ДНК, активация нейтрофилов.

Известно, что при травме в кровоток попадает содержимое разрушенных клеток, в т.ч. компоненты митохондрий. Они могут функционировать в качестве эндогенных «образов опасности», ассоциированных с повреждением (Damage-associated molecular patterns, DAMPs), и инициировать воспаление, которое в ряде случаев приводит к развитию опасных для жизни осложнений [1]. Предположительно активация клеток иммунной системы с помощью митохондриаль-

Принятые сокращения: мтДНК — митохондриальная ДНК; внДНК — внеклеточная ДНК; яДНК — ядерная ДНК; DAMP — «образы опасности», ассоциированные с повреждением (Damage-associated molecular patterns); MTD - митохондриальные DAMP; fMLP - formyl-Met-Leu-Phe; ISS — шкала тяжести повреждений (Injury Severity Score); Р-р38 — фосфорилированная форма МАРК р38; ММР9 — матриксная металлопротеиназа (Matrix metallo-proteinase 9).

* Адресат для корреспонденции.

ных DAMP (MTD) вызывается: 1) митохондри-альными белками, несущими на ^-концах фор-милметионин, что типично для бактериальных белков; 2) митохондриальным кардиолипином; 3) АТФ; 4) митохондриальной ДНК (мтДНК), обладающей многими свойствами прокариоти-ческой ДНК [1, 2]. Внеклеточная ДНК (внДНК) в плазме крови представлена в основном ядерной (яДНК) и мтДНК. Показано, что повышение концентрации внДНК наблюдается при множестве патологических состояний [3]. Повышение концентрации мтДНК в крови пациентов с травмой может являться потенциальным прогностическим маркером [4, 5], коррелирующим с тяжестью травмы и смертностью [6, 7].

В подавляющем большинстве работ, посвященных изучению мтДНК, исследователи оперируют относительными, а не абсолютными значениями концентраций. Точное определение концентраций мтДНК может помочь система-

тизировать результаты, полученные в разных исследованиях, а также разобраться в механизме действия этих нуклеиновых кислот как DAMP. В настоящей работе мы исследовали данный вопрос с помощью количественного определения внеклеточной ДНК в плазме крови 34 больных с тяжелой травмой.

Остается неясным, способна ли мтДНК в концентрациях, соответствующих физиологическим значениям, вызывать активацию иммунного ответа. Мы провели независимую проверку данных об активации нейтрофилов человека с помощью мтДНК и обнаружили, что очищенная мтДНК не вызывает активации нейтро-филов. В ранее опубликованных работах, по-видимому, были использованы недостаточно очищенные препараты мтДНК, примеси в которых и вызывали подобную активацию.

Полученные результаты подтверждают ценность мтДНК как прогностического фактора смертности у пациентов с тяжелой травмой и, одновременно, поднимают вопрос о существовании дополнительных факторов, позволяющих мтДНК функционировать в качестве DAMP.

МЕТОДЫ ИССЛЕДОВАНИЯ

Характеристика пациентов. Работу проводили с разрешения этического комитета НИИ скорой помощи им. Н.В. Склифосовского. В работе была исследована кровь 34 пострадавших с тяжелой сочетанной травмой, которые находились на лечении в отделении реанимации и интенсивной терапии НИИ им. Н.В. Склифосовского в 2012—2014 гг., и кровь 10 здоровых добровольцев из числа врачей-ординаторов. В исследование не включали пациентов с комбинированной травмой и пациентов старше 70 лет. Тяжесть травмы оценивали по шкале тяжести повреждений — Injury Severity Score (ISS) с учетом их локализации: голова, грудь, живот, позвоночник, таз и конечности. Характеристика пострадавших представлена в табл. 1.

Пробоподготовка и выделение ДНК из плазмы крови. Через 24 ч после травмы у пострадавших отбирали 3 мл периферической венозной крови. Перед забором крови пациенты находились в состоянии покоя не менее 10 мин. Кровь, смешанную с ЭДТА (1,5 мг/мл), центрифугировали в течение 10 мин при 3000 g. Отобранную плазму дополнительно центрифугировали 10 мин при 10 000 g. Верхнюю порцию плазмы помещали в микроцентрифужную пробирку объемом 0,5 мл и замораживали при —20° до выделения ДНК. Для контроля эффективности выделения в каждый образец плазмы объемом 0,4 мл перед про-

Таблица 1. Характеристика пострадавших с тяжелой соче-танной травмой

Характеристики Выжившие Умершие

Количество пациентов 25 9

Возраст, лет* 40 (28-50) 26 (22-59)

Мужчины 19 9

Женщины 6 0

Тяжесть повреждений 41 (34-41) 48 (43-57)

по шкале ISS, баллы*

Нозокомиальная 16 7

пневмония

Без пневмонии 9 2

* Указаны медианные значения (межквартильный интервал).

цедурой выделения вносили по 10 мкл (1,7 нг/мкл) экзогенной контрольной ДНК на основе плаз-миды pBlueScriptSKII(-) размером 8 кб. Выделение ДНК из 100 мкл плазмы крови проводили с помощью набора Quick-gDNA Blood MiniPrep («Zymo Research», США) по протоколу производителя.

ПЦР в реальном времени. Количественную ПЦР в реальном времени проводили в ампли-фикаторе iCycler («Bio-Rad», США) со смесью следующего состава: 5 мкл анализируемого образца; 10 мкл смеси Б Eva Green («Синтол», Россия); 0,5 мкл смеси каждого из специфичных праймеров (10 мкМ); 9,5 мкл деионизованной воды. Каждый образец ДНК использовали в качестве матрицы в трех идентичных ПЦР-реак-циях. Последовательности используемых прай-меров указаны в табл. 2. Специфичность праймеров к мтДНК была дополнительно подтверждена с использованием ДНК из клеток эндотелия человека EA.hy926 без мтДНК (Rho0). Эффективность подобранных пар праймеров составила 93—101%. Реакцию ПЦР проводили в следующих условиях: 94° — 5 мин; 40 циклов: 94° — 20 с, 56° - 20 с, 72° - 20 с; 72° - 5 мин. Эффективность ПЦР рассчитывали с использованием серии разведений от 1 пг/мл до 10 мкг/мл препаратов тотальной ДНК из клеток HeLa («NEB», Англия) или серии разведений, приготовленных на матрице контрольной плазмиды. Нормализацию результатов проводили с учетом амплификации контрольной последовательности вносимой плазмидной ДНК [8].

Выделение нейтрофилов. Венозную кровь здоровых доноров собирали в гепаринизирован-

Таблица 2. Характеристика праймеров

Мишень Прямой праймер (5'—3') Обратный праймер (5'—3')

яДНК человека, ретротранспозон LINE1 мтДНК человека, участок D-петли Контрольная плазмида, 8 кб ACCTGCTCCTGAATGACTA ACCCTATGTCGCAGTATCTGTC GCCAGGGTTTTCCCAGTCACGA GATTCTGGTATGTGGTGTCTT ATGATGTCTGTGTGGAAAGTGG ATTTGACTTTAGCCAGGTAGC

ные пробирки. Полиморфноядерные лейкоциты (нейтрофилы) были выделены с помощью седиментации с декстраном и последующим центрифугированием в градиенте Фиколл-Пак (плотность 1,077 г/мл) [1]. Полученные нейтрофилы ресуспендировали в среде RPMI-1640 («ПанЭко», Россия), содержавшей 10%-ную телячью сыворотку с низким содержанием эндотоксинов («PAA Laboratories», Германия). Жизнеспособность нейтрофилов (>98%) определяли окраской трипановым синим.

Зимография. Выделенные нейтрофилы (1 х 106 в 1 мл) обрабатывали fMLP (formyl-Met-Leu-Phe), мтДНК или MTD в конечном объеме 0,5 мл в течение 1 ч при 37° в атмосфере 5%-ного CO2. Количество секретируемой нейтрофилами желати-назы ММР9 определяли с помощью зимогра-фии в ПААГ, содержавшем 1 мг/мл желатина, по стандартной методике, описанной ранее [9].

Вестерн-блот. После инкубации с тестируемыми активаторами нейтрофилы лизировали в горячем буфере (62,5 мM Tris-HCl, pH 6,8; 2%-ный SDS; 10%-ный глицерин; 50 мM ДТТ, 0,01% бром-фенолового синего) в течение 4 мин при 95°. Белки разделяли в 12%-ном ПААГ и переносили на PVDF-мембраны («Amersham», США). Были использованы антитела к р-актину, p-38 и P-p38 («Cell Signaling», США), а также вторичные антитела, конъюгированные с пероксидазой хрена («Sigma-Aldrich», США). Визуализацию проводили набором ECL («Amersham», США). Для денситометрического анализа использовали программу ImageJ 1.44p.

Выделение митохондриальных DAMP. Фракцию митохондрий выделяли из печени крыс или линии эндотелиальных клеток человека EA.hy926 с помощью дифференциального центрифугирования по протоколу, описанному ранее [1]. Для приготовления суспензии разрушенных митохондрий к фракции митохондрий добавляли протеиназный ингибитор («Amresco», США) и проводили озвучивание во льду на аппарате Branson Sonifier 150 («Branson Ultrasonics Corporation», США) при 100%-ной амплитуде, 10 раз по 30 с, с интервалом в 30 с. Суспензию разрушенных митохондрий центрифугировали

при 15 000 g (10 мин, 4°), затем при 100 000 g (1 ч, 4°). Концент

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Химия»