научная статья по теме S100A3 – НОВЫЙ ГЕН-МИШЕНЬ БЕЛКА КАИЗО В КОЖЕ МЛЕКОПИТАЮЩИХ Биология

Текст научной статьи на тему «S100A3 – НОВЫЙ ГЕН-МИШЕНЬ БЕЛКА КАИЗО В КОЖЕ МЛЕКОПИТАЮЩИХ»

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ, 2015, том 49, № 2, с. 362-365

КРАТКИЕ ^^^^^^^^^^^^ СООБЩЕНИЯ

УДК 577.21

S100A3 - НОВЫЙ ГЕН-МИШЕНЬ БЕЛКА КАИЗО В КОЖЕ

МЛЕКОПИТАЮЩИХ

© 2015 г. Н. А. Жигалова*, А. С. Соколов, Е. Б. Прохорчук, С. В. Женило

Центр "Биоинженерия"Российской академии наук, Москва, 117312 Поступила в редакцию 29.04.2014 г. Принята к печати 20.10.2014 г.

Ключевые слова: белок Каизо, метилирование ДНК, S100A3.

S100A3 IS A NEW TARGET GENE OF KAISO IN MOUSE SKIN, by N. A. Zhigalova*, A. S. Sokolov, E. B. Prokhortchouk, S. V. Zhenilo (Center "Bioengineering" Russian Academy of Sciences, Moscow, 117312 Russia; *e-mail: nzhigalova@gmail.com).

Keywords: Kaiso, DNA methylation, S100A3.

DOI: 10.7868/S0026898415020184

Метил-ДНК-связывающий белок Каизо — член BTB/POZ-семейства транскрипционных факторов и содержит два функциональных домена: на N-конце — BTB/POZ-домен и на С-конце — домен "три цинковых пальца" С2Н2-типа [1]. Этот бимодальный ДНК-связывающий белок способен распознавать участки, содержащие как метилированную mCpGmCpG, так и неметилированную специфическую последовательность CTGCNA (КСС-Каизо связывающий сайт) [2—4]. Последняя характерна для промоторных областей генов Wnt11, matrilysin-7 и Siamois у лягушки Xenopus laevis. Показано, что наличие 5-гидроксиметил-цитозина в составе КСС приводит к ингибирова-нию связывания белка Каизо с ДНК [5]. До сих пор между разными группами исследователей нет полного согласия в том, какая из ДНК-связываю-щих активностей белка Каизо — с метилированными участками, с неметилированной последовательностью или с ними обоими — является основной в живой клетке. Показано, что белок Каизо необходим для развития амфибий. Уменьшение количества этого белка у лягушки Xenopus laevis и у рыбы Danio rerio приводит к гибели эмбрионов в результате преждевременной активации генов в бластуле и повышенной экспрессии гена Wnt11 [6—8]. С другой стороны, генетический нокаут гена Kaiso у мышей не приводит к изменению фенотипа. Тем не менее, в гибридах при скрещивании мышей линий Kaiso-/y и APC/Min проявляется устойчивость к возникновению рака кишечника. Прямых генов-мишеней для белка Каизо до настоящего времени не обнаружено [9].

* Эл. почта: nzhigalova@gmail.com

Задача представленной работы — поиски генов-мишеней белка Каизо. Для этого проводили экспрессионный анализ на микроматрицах MouseRef-8 ("Illumina", США) тотальной РНК, выделенной из кожи мышей линии "дикого" типа C57BL/6 и линии мышей, нокаутированных по гену Каизо, — Kaiso-/y. В результате выявлено 1599 (p-value < 0.01) генов, экспрессия которых в коже мышей линии Kaiso-/у, по сравнению с линией мышей C57BL/6, изменяется (рис. 1а). При помощи метода "генной онтологии" были определены гены с повышенным уровнем экспрессии, которые вовлечены в такие процессы, как диффе-ренцировка эпидермиса, морфогенез, созревание кератиноцитов, формирование цитоскелета, развитие эктодермы, а также группа генов (S100A3, Sprr, Padi3, Padi3 и т.д.), локализованных в центральном домене эпидермального дифференци-ровочного комплекса (ЕДК), важного для барьерной функции эпидермиса (рис. 1б) [10]

Для подтверждения данных, полученных в результате гибридизации РНК с микроматрицами, был выбран ген S100A3, экспрессия которого у мышей линии Kaiso-/y значительно повышена. При помощи ПЦР в реальном времени мы подтвердили, что экспрессия гена S100A3 увеличена у мышей Kaiso-/y более чем в 200 раз (данные не представлены). Ген S100A3 локализован в эпидер-мальном дифференцировочном комплексе на хромосоме 3 у мышей. Белок S100A3 относится к Ca2+-связывающему S100-семейству белков и активно синтезируется в кутикуле волосяных фолликул и волоса. Ферменты PADI1 и PADI3

925

Гены с повышенной экспрессией Гены с пониженной экспрессией

Промежуточный филамент Промежуточный филамент цитоскелета Часть цитоскелета Цитоскелет Свободные органеллы Внутриклеточные свободные органеллы Морфогенез ткани Кератинизация Морфогенез эпидермиса Развитие эпидермиса Структурные компоненты цитоскелета Развитие эктодермы Дифференцировка клеток эпидермиса Развитие ткани

6 8 10 12 lg (p-value)

Рис. 1. Анализ суммарной экспрессии генов. а — Число генов, экспрессия которых в коже мышей линии Ка^о-/у и линии С57БЬ/6 мышей отличается (р < 0.01); б — анализ генов (с повышенной экспрессией) мышей линии Ка^о-/у при использовании метода "генной онтологии" (р < 0.01).

а

конвертируют Arg-51 белка S100A3 в цитруллин, что способствует формированию тетраметров белка. Только в такой форме S100A3 может выполнять барьерные функции волоса [11].

Мы предположили, что S100A3 может являться прямым геном-мишенью метил-ДНК-связы-вающего белка Каизо. Для подтверждения гипотезы мы использовали метод иммунопреципита-ции хроматина с последующим ПЦР-анализом. Были подобраны праймеры к различным участкам данного гена (база данных Ensemble ENSMUSG00000001021.): к промоторной области (—460...—320) - 5'-AGCCTTCTCTCTAG-GCTTCAA, 5 ' - TGTACCTCCAGAGAGTATCTG ; (-242.-88) - 5'-TAGCTGGAAGATGCAAGCAG, 5'-TCAGTAGCCTCTATTACAGG; к первому экзо-ну (-106...+119) - 5 ' - CTGTAATAGAGGCTACT-GAGG, 5'-TGTTGAGGGCTTTCTGAGCT; к интрону (+211...+403) - 5'-AGGAGCTGTAAG-GAAGTTTGTT, 5'-AAAGGAATCCTCTCTTCTCCT. Антитела против белка Каизо использовали для иммунопреципитации хроматина, выделенного из кожи мышей "дикого" типа и линии Kaiso-/y. ПЦР-анализ ДНК после иммунопреципитации показал, что белок Каизо связывает in vivo промо-торную область и экзоны гена S100A3 (рис. 2а). Регуляторные участки гена S100A3 содержат только единичные CpG-динуклеотиды, а не классические для Каизо последовательности (КСС и "CpG островки").

Мы предположили, что найденные в регуля-торной области гена S100A3 одиночные CpG ме-

тилированы. Методом бисульфитной конверсии геномной ДНК, выделенной из кожи мышей, показано, что единичные CpG-динуклеотиды, действительно, метилированы в промоторной области гена S100A3 как у мышей линии Kaiso-/y, так и у мышей дикого типа (рис. 2б).

Для подтверждения связывания белка Каизо с метилированными одиночными CpG-динуклео-тидами гена S100A3 in vitro мы поставили опыт по задержке ДНК-белковых комплексов в геле. Предварительно в клетках Esherichia coli UBS520BL синтезировали и наработали необходимое количество рекомбинантного химерного белка Kaiso-ZF-GST, содержащего глутатион^-трансферазный домен и домен "цинковые пальцы" белка Каизо мыши (344—638 а.о.). Последовательности ДНК, соответствующие участкам (-460.-320), (-242.-88), (—106...+119) гена S100A3, метилировали при помощи SSSI-метилазы. Опыт по задержке ДНК-белкового комплекса при электрофорезе в геле проводили, как описано ранее [12]. Результаты подтвердили способность "цинковых пальцев" белка Каизо связывать метилированные единичные CpG-динуклеотиды промотора и первого эк-зона гена S100A3 in vitro (рис. 2в). Раннее было показано, что гидроксиметилирование в последовательности КСС препятствует связыванию белка Каизо с ДНК [5]. Мы проверили, какое влияние оказывает гидроксиметилирование в составе CpG-динуклеотидов на взаимодействие белка Каизо с ДНК. В качестве ДНК-субстрата в опыте по задержке в геле использовали последовательность из про-

364

C57BL/6 Kaiso-/y 1 2 3 4 5 6

район

ЖИГАЛОВА и др.

б

(-460.-320)

(-460.-320) Промотор

(-242.-88)

(-106...+119) I экзон

(+211...+403)

(+420...+593) Интрон

(+670...+952)

(+971...+1150)

(+1222...+1482)

(+1474...+ 1796) II экзон

J 1 м N +1

S100a3

- 419 -164-128 - 114 '

C57BL/6

Kaiso-/y

(+1865...+2154) (+2135...+2303) (+2281...+2475)

(+2503...+2692) (+2789...+3024)

III экзон

-о-

3' нетранслируемая область

в M + — + — + — + -

Kaiso-ZF-GST ^Л ^Л /Л ^Л ^Л ^Л ^Л /Л

-460.-320 -242.-88 -106...+119

CG11

• 9

• •

—л-щ-

-ш—• •

-#—•--•—О-*

-•—Q-+

-О—О-СГ

о-

<5-

-о*

68%

"О—0~0" -О-О-о -О—СгО-

64%

о-о-о--О—О-О--О-О-О-

г mC C hmC Kaiso-ZF-GST ^-""1 --""I --""I

Рис. 2. Белок Каизо связывает метилированые CpG в промоторе и экзоне гена S100A3 in vitro и in vivo в ДНК кожи мышей. а - Данные ПЦР на ДНК мышей линии C57BL/6 после иммунопреципитации хроматина из кожи мышей: 1-исходное количество ДНК; 2 - без добавления антител; 3 - после добавления антител ZFH6 [4] к белку Каизо с использованием мышей линии C57BL/6; 4 - без добавления антител; 5 - после добавления антител ZFH6 к белку Каизо; 6 - исходное количество ДНК с использованием мышей линии Kaiso-/y. б - Определение уровня метилирования ДНК в промоторе и экзоне гена S100A3. Закрашенные кружки - метилированные CpG, незакрашенные - неметилирован-ные CpG. в, г — Результаты опытов по задержке ДНК-белковых комплексов в 1%-ном агарозном геле (в) и в 4% ПААГ (г). (M+) - метилированные и (M-) - неметилированные последовательности, Kaiso-ZF-GST - синтезированный в бактериях белок, CG11 - контроль (последовательность, с которой связывается белок Каизо [4]), треугольники означают увеличение концентрации рекомбинантного белка, стрелка указывает на ДНК-белковый комплекс.

моторной области гена Б100Л3 (—242...—88) — 5'-ССТТТССТССЛОКОАЛЛТЛЛОСЛЛТТ, где в положении N может быть неметилированный, метилированный или гидроксиметилированный цитозин. Введение гидроксиметилированного ци-тозина в СрО-динуклеотид приводит к потере сродства цинковых пальцев белка Каизо к ДНК (рис. 2г).

Таким образом, в данной работе найдено 1599 генов, экспрессия которых в ДНК кожи мыши

изменяется при отсутствии белка Каизо. Мы показали, что ген S100A3 представляет собой новый ген-мишень для метил-ДНК-связывающего белка Каизо. Впервые показано, что этот белок может связывать последовательности ДНК, содержащие единичные метилированные CpG-динук-леотиды в промоторе и экзонах гена S100A3 in vitro и in vivo, в коже мышей. При этом, гидрок-симетилирование тех же CpG приводит к потере сродства белка Каизо к ДНК.

В настоящее время — на фоне хорошо охарактеризованной кристаллической структуры и посттрансляционных модификаций белка S100A3 — остается мало изученной регуляция его синтеза и роль в коже млекопитающих. При этом роль ме-тил-ДНК-связывающего белка Каизо в коже млекопитающих остается

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»