ФИЗИОЛОГИЯ РАСТЕНИЙ, 2015, том 62, № 5, с. 668-674
ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ
y%K 581.1
SELENIUM TOLERANCE OF AN Arabidopsis DROUGHT-RESISTANT
MUTANT csml-11
© 2015 L. Jiang*, Q. C. Gao*, Z. P. Chen*, **, J. J. Zhang*, X. Y. Bai*, X. L. He*, Q. X. Xu*
*School of Biotechnology and Food Engineering, Hefei University of Technology,
Hefei, Anhui, China
**School of Life Science, Nanjing Agricultural University, Nanjing, Jiangsu, China
Received August 30, 2014
We isolated the Arabidopsis drought-resistant mutant csm1-1 and cloned the CSM1 gene (previously called RCI3) which encodes a kind of peroxidase. In this study, we showed that the mutant csm1-1 was more tolerant to selenium (Se) stress than the wild-type, and that the mutant csm1-1 accumulated similar Se content compared with the wild-type when subjected to Se stress. Further analysis revealed that the Se resistance of mutant csm1-1 was associated, at least in part, with the enhanced activities of antioxidant enzymes GSH-POD (glutathione peroxidase) and POD (peroxidase). In addition, enhanced Se resistance of the mutant csm1-1 was partially GSH dependent, which was related to the higher expression level of GSH1 gene involved in GSH synthesis and consequently increased GSH content.
Keywords: Arabidopsis thaliana — selenite stress — csm1-1 mutant — RCI3gene
DOI: 10.7868/S0015330315050097
INTRODUCTION
Selenium (Se) is an important trace element for animal and plant but it is toxic at higher level. For the first time it was reported in 1957 [1] that Se had the nutritional benefit. It was assimilated into roots of plants from soil and water in the inorganic form of selenate [Se (VI)] — selenite [Se (IV)]. The Se metabolism was related to the sulfate transporters and key enzymes of the S assimilatory pathway in Arabidopsis [2, 3]. Some recent reports have demonstrated that selenite uptake, at least partly, mediated by phosphate transporters [4, 5] and the silicon transporter [6]. Se is essential for the biosynthesis of selenocysteine (SeCys) which is the active site of glutathione peroxidase (GSH-POD), a free-radical scavenger in plants [7]. A lot of studies have identified the key genes involved in selenium tolerance in plants, for example, the overexpression of AtCpNiffS, a chloroplastic NifS-like protein, can enhance Se tolerance and accumulation and catalyze selenocysteine into alanine and elemental selenium in
1 This text was submitted by the authors in English.
Abbreviations: BSO — L-buthionine-S,R-sulfoximine; Col-0 — Co-lombia-0; csm1-1 — drought-resistant mutant; GSH — glutathione; GSH-POD — glutathione peroxidase; POD — peroxidase; RCI3 — Rare Cold Inducible gene 3; T-GSH - total glutathione; WT — wild type.
Corresponding author: Li Jiang. School of Biotechnology and Food Engineering, Hefei University of Technology, 193 Tunxi Road, Hefei, Anhui, 230009; People's Republic of China; fax: +86-551-62901539; e-mail: jiangli@ustc.edu.cn
Arabidopsis [8]. Selenium tolerance improved due to higher levels of NO in mutant gsnor1-3, and the double mutant nia1nia2 produced less NO and became more sensitive to selenium [9]. However, our understanding of molecular mechanisms of selenium tolerance is far from complete.
In 2002, Llorente et al. [10] reported that a novel cold-inducible gene, RCI3, encodes a peroxidase in Arabidopsis, and RCI3 is involved in the tolerance to dehydration and salt stresses. In our laboratory, we isolated the drought-resistant mutant csm1-1 and cloned the CSM1 gene which codes a kind ofperoxidase (RCI3, Rare Cold Inducible gene 3) [11]. The sequencing results indicate that T-DNA with 35S promoter was inserted into the upstream of the RCI3 gene, which activating RCI3 gene expression, so when subjected to drought stress the transcript level of RCI3 in the mutant csm1-1 plants was significantly higher than that in wildtype (WT) plants [11].
In this study, we found that csm1-1 mutant plants showed enhanced resistance to Se stress compared with the WT plants. The csm1-1 mutant plants had higher GSH content and GSH-POD activity compared with the WT plants. In addition, the expressions of GSH1 and GPX1 genes in the csm1-1 plants were higher than those in WT plants subjected to selenite stress. Our results demonstrated that the RCI3 gene is involved in the regulation of Se stress, at least in part, depending on a GSH-mediated mechanism.
MATERIALS AND METHODS
Plant growth conditions and treatments. Seeds of Arabidopsis (Arabidopsis thaliana (L.) Heynh.) wildtype (WT) ecotype Colombia-0 (Col-0), were purchased from the Arabidopsis Biological Resource Center ("ABRC"; Ohio State University, Columbus, United States), and the csm1-1 mutant seeds were obtained by our laboratory from T-DNA mutants ("ABRC"). Seeds were surface sterilized and plated on 1/2 MS medium containing 1% agar and 1.5% sucrose, placed for 2 days in the dark at 4°C. Plates were then moved in a controlled growth chamber at 22°C, 100 ^mol/(m2 s), and 16 h light/8 h dark.
For Na2SeO3 resistance tests and buthionine sul-foximine (BSO, an inhibitor of glutathione synthesis) treatment tests, the WT and mutant csm1-1 seeds were germinated and grown vertically on 1/2 MS medium containing indicated concentrations of Na2SeO3 or BSO ("Sigma", USA). After 3 weeks, plants were sampled for root growth assay and fresh weight measurements [12].
Measurements of Se content. Three-week-old WT and mutant csm1-1 seedlings grown on 1/2 MS medium were moved into media with or without 30 ^M Na2SeO3 for 24 h, and then immersed to eliminate any external Se in double distilled water. Treated plants were digested with 5 mL HNO3 and 1 mL 30% HCl overnight in closed containers. The digested samples were diluted with 3% HCl to 25 mL, and analyzed using atomic fluorescence absorption spectrometer [13].
Measurements of physiological indices. Three-week-old WT and mutant csm1-1 seedlings grown on 1/2 MS medium were treated with 30 ^M Na2SeO3 for 24 h.
Glutathione (GSH) content was tested using GSH and GSSG Assay Kit ("Beyotime Institute of Biotechnology") following the manufacturer's instructions. Total glutathione (GSSG+GSH, T-GSH), determining the yellow TNB formation which was produced by the reaction of GSH and chromogenic substrate (5,5'-dithio-bis(2-nitrobenzoic acid), DTNB Ellman's Reagent), was tested by measuring the absorbance at 412 nm (A412). With GSH of the sample in the appropriate reagent removal samples first, the content of GSH can be calculated with total GSH the amount of deduction of GSSG content.
GSH-POD activity was tested using Cellular Glutathione Peroxidase Assay Kit ("Beyotime Institute of Biotechnology") following the manufacturer's instructions. GSH was oxidized by glutathione peroxidase to GSSG, which was reduced by glutathione reductase to GSH with NADPH. Glutathione peroxidase activity was tested by the decrement of NADPH, measuring the decrease of absorbance at 340 nm (A340).
POD activity was determined using guaiacol oxidation assay. Dark brown material, generated from guai-
acol which was oxidized by peroxidase, was measured using spectrophotometer at 470 nm (A470).
Quantitative real-time PCR analysis. Ten-day-old csm1-1 mutant seedlings and wild-type seedlings grown on 1/2 MS medium were diverted to nutrient solution with or without 30 ^M Na2SeO3 for 12 h, and then total RNA of the samples was extracted using the Trizol Reagent ("Invitrogen", United States). DNase-treat-ed total RNA were converted into cDNA by Transcript First-Strand cDNA Synthesis SuperMix following the manufacturer's instructions. Quantitative real-time PCR was performed according to the instructions provided for Bio-Rad iCycler iQ system ("Bio-Rad Laboratories") with platinum SYBR Green quantitative PCR SuperMix-UDG ("Invitrogen"). The fold change of transcripts was calculated based on an efficiency calibrated model and compared with the transcript level under normal conditions. Statistical differences between samples were evaluated by Student's test using delta Ct values.
In each experiment, the mean of three biological replicates are used to generate mean and statistical significance. Three experiments on independently grown plant material were performed to confirm that the results are reproducible. ACTIN11 was used to normalize the reactions [14, 15]. The following primers were designed for gene-specific transcript amplifications [13, 16]: ACTIN11 (ACTIN, At3g12110) - forward, 5'-GATTTGGCATCACA-CTTTCTACAATG-3', and reverse, 5'-GTTCCAC-CACTGAGCACAATG-3'; AtGSH1 (At4g23100) -forward, 5'-TCTTTTGGGTTTGAGCAGTAT-3', and reverse, 5' - ATATGAAGGCAGTTCACCAGG- 3'; AtGPX1 (At2G25080) - forward, 5'-ACCGTTCAC-GATTTCACC-3', and reverse, 5'-ACCACCCAA-GAATCCTCC-3'; AtATM3 (At5g58270) - forward, 5' - CAGGCTGACCACTGCGATGC - 3', and reverse, 5'-TTGGCTCTGAGGTTCACTATTCC-3'.
Statistical analysis. The experimental data are the means ± SE of three replicated groups. The analyses of variance were computed on statistically significant differences (P < 0.05) determined based on the appropriate /-tests. The mean differences were compared utilizing Duncan's multiple range test.
RESULTS
Enhanced resistance of csm1-1 mutant plants to Se stress
To analyze the phenotype characteristic of the mutant csm1-1 to Se stress, seeds of the WT and mutant csm1-1 were seeded on 1/2 MS media containing 0, 15, or 30 ^M Na2SeO3 and grown in vertical culture for 3 weeks. There were no significant differences between the WT and the mutant csm1-1 plants that were grown on 1/2 MS media. However, when treated with 15 and 30 ^M Na2SeO3, the mutant csm1-1 seedlings were more resistant to Se than WT seedlings (fig. 1a).
WT csm1-1 ( ) WT csm1-1
£ 4
o ^ 1
1 2
(b)
0
15
30
Na2SeO3 concentration,
0.08
o 0.06
, 0.04
is 0.02
h
s e
Fr 0
1 2
0
(c)
15
30
Na2SeO3 concentration,
Fig. 1. Phenotypes of WT (1) and csm1-1 mutant (2) subjected to Na2SeO3.
a — representative phenotypes ofWT and csm1-1 mutant grown in the media
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.