ГЕНЕТИКА, 2013, том 49, № 12, с. 1357-1363
== МОЛЕКУЛЯРНАЯ ГЕНЕТИКА
УДК 576:595.771
SUBSTITUTION BIAS AND EVOLUTIONARY RATE OF MITOCHONDRIAL PROTEIN-ENCODING GENES IN FOUR SPECIES OF CECIDOMYIIDAE
© 2013 Y. Duan- b, R. H. Wub, Y. L. Jiangb, T. Lib, Y. Q. Wub, L. Z. Luoa
"State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, 100193 China e-mail: duanyunhao@163.com bKey Laboratory of Crop Pest Control of Henan Province, Key Laboratory of Pest Management in South of North-China for Ministry of Agriculture of PRC, Institute of Plant Protection, Henan Academy of Agricultural Sciences, Zhengzhou, 450002 China Received January 17, 2013
Five mitochondrial protein-encoding genes (COX1, COX2, CytB, ND4 and ND5) from the wheat midge, Si-todiplosis mosellana (Diptera: Cecidomyiidae), were sequenced and compared with those of 3 other Cecido-myiidae species, Mayetiola destructor, Rhopalomyia pomum and Asphondylia rosetta. These genes shared similar AT content (74.0—80.1%) and base substitution bias in favour of transversions (68.87—79.72%) over transitions (20.28—37.04%). Substitution saturation analyses indicated fast saturation of transitional substitutions in COX2, CytB, ND4 and ND5, especially at the 3rd codon positions. Analysis of interspecific divergence among the 4 species showed that the sequence divergence rates (evolutionary rates) were in the order of ND4 = CytB > COX2 = ND5 > COX1. Intraspecific genetic polymorphism analysis within the field populations of S. mosellana indicated that ND4 had the highest genetic polymorphism and COX1 the lowest. Genetic variation patterns suggested that COX1 could be used as a molecular marker for phylogenetic analysis across a relatively wide taxonomic range in Cecidomyiidae, while COX2 and ND5 may be useful for estimating relationships at a subgenus level or among closely related species. With its high genetic polymorphism, ND4 was the molecular marker most suitable for population genetics studies. These findings will be valuable for our further understanding and studies in evolutionary biology and population genetics for S. mosellana and other Ceci-domyiidae insects.
DOI: 10.7868/S0016675813100020
Insect mitochondrial DNA (mtDNA) provides useful molecular markers because of its intrinsic features, including simple structure, high rate of evolution, and conserved gene content [1, 2]. Insect mitochondrial genomes generally have 13 protein-encoding genes, which show diverse variation among individuals and species in structure and function. Differences in basic parameters such as sequence length, base composition, codon usage, patterns of nucleotide substitution, rate variation among sites, sequence divergence, and evolutionary rate can lead to various experimental applications [3—6]. For example, cytochrome oxidase subunit I (COX1) with a slow evolutionary rate has been most frequently used in systematics applications [7—9], while NADH dehydrogenase subunit 4 (ND4), with a relatively fast evolutionary rate, is often used in population genetics studies [10-12].
Cecidomyiidae is an important family of dipteran insects with >5700 described species, including agricultural pests (e. g. Sitodiplosis mosellana and Mayetiola destructor) and natural enemies (e. g. Aphidoletes aphidimyza). However, the phylogeny of this family and the population genetics in some important species remain unclear. The mtDNA of several Cecidomyi-
idae species has been sequenced and used to study the mitochondrial genome structure, species identification, population genetics and phylogenetic reconstruction [11, 13-15]. But the molecular evolutionary patterns in the family of Cecidomyiidae remain less understood compared to other Dipteran taxa. The genetic markers for population studies of S. mosellana and other Cecidomyiidae species are limited as well.
In this study, 5 mitochondrial protein-encoding genes (COX1, cytochrome oxidase subunit II (COX2), cytochrome B (CytB), ND4 and NADH dehydrogenase subunit 5 (ND5)) were selected to elucidate their patterns of nucleotide substitutions, rate variation among sites, and interspecific divergence in 4 species of Cecidomyiidae (S. mosellana, M. destructor, Rhopalomyia pomum and Asphondrlia rosetta). The in-traspecific polymorphism within the field populations of S. mosellana was also investigated. Our data will provide better understanding of the evolution of these genes in Cecidomyiidae and valuable information for future studies of evolutionary biology and population genetics.
Table 1. Primers for amplification of mitochondrial protein-encoding genes from S. mosellana
Gene Primer sequences (5'—3') Fragment length, bp Annealing temperature, °C Accession No.
COX1 F: TATTTTTGGAATTTGAGCTGG R:GTAAATATATGATGAGCTCAYAC 822 50 JQ609303
COX2 F: CGGAAATTCTCCTTTAATAGAAC R:GCTCCGCAAATTTCTGAACATT 570 51 JQ609302
CytBa F: GAGGWCAAATATCATTTTGAGG R:CCTCGTTATCGTTATGATAAATT 897 51 JQ609300
ND4 F: GAAATAGGAGAAGATATATT R:TTGAAATAAGATTAATTCCTAC 727 45 HQ435315
ND5 F: CCACATAAAGCTAATCTAG R:TTTTAATTGGTTGAGATGGT 718 48 JQ609299
a CytB = CytB (732 bp) + tRNA-Ser (79 bp) + ND1 (108 bp).
MATERIALS AND METHODS
Insect collection. In April and May 2011, soil samples containing overwintered larvae of S. mosellana were collected from Huixian (Henan) (35°32' N, 113°45' E), Luanchuan (Henan) (33°47' N, 111°34' E), Shizuishan (Ningxia Hui Autonomous Region) (39° 10' N, 106°39' E) and Linfen (Shanxi) (36° 12' N, 111 °41' E) in China. Larvae were maintained at 22 ± ± 1°C, 70-75% RH and a photoperiod of 14 h light: 10 h dark through pupation and adult emergence. Adults were collected daily until a total of 20 were accumulated for each site, and were stored individually in 75% ethanol at -20°C.
Genomic DNA extraction. Genomic DNA was extracted from individual adults of S. mosellana as described below. Each specimen was ground in a 1.5-mL microfuge tube containing 50 ^L of DNA extraction buffer (1% SDS, 50 mmol/L Tris-HCl, pH 8.0, 25 mmol/L NaCl, 25 mmol/L EDTA), and incubated for 45 min at 65°C. Fifty microliters of 3 mol/L potassium acetate (pH 7.2) was added, followed by gentle mixing and incubation for 1 h on ice. The solution was centrifuged for 15 min at 12.000 rpm. The supernatant was transferred to a new tube and 200 ^L 100% ethanol was added. After holding at -20°C for >1 h, the tube was centrifuged for 15 min at 12.000 rpm, and the supernatant removed. The pellet was washed with 1 mL 70% ethanol and centrifuged for 1 min at 12.000 rpm, and dried for 15 min at room temperature. The pellet, consisting of total DNA, was dissolved in 20 ^L sterilized deionized distilled water, and stored at — 20°C. Total DNA was analyzed by 1% agarose gel electro-phoresis.
Primer design and synthesis. Mitochondrial genomes of M. destructor (GQ387648), R. pomum (GQ387649) and A. rosetta (GQ387650) were downloaded from NCBI [15], and aligned using Clustalx2 (version 2.0.12) [16]. Primer sequences for amplifying the target genes from S. mosellana were designed from conserved sequences, using Primer Premier 5.0 soft-
ware [17], and synthesized by Sangon Biotech (Shanghai) Co. Ltd. (Shanghai, China). Primer information is shown in Table 1. The same primers were used for the sequencing reactions.
Cloning and sequencing. PCR was carried out in a 20-|L reaction mixture containing 20—40 ng total DNA, 2.0 |L of 10x Taq DNA polymerase reaction buffer (Mg2+ free ), 1.8 |L of 25 mmol/L Mg2+, 2 |L 0.5 mmol/L dNTPs, 1.0 |L of each primer at 10 pmol/|L, 10 |L deionized distilled water, 0.2 |L of TaqE (5 U/|L) (Takara, Japan) and 2 |L of DNA template. Reactions were carried out on a SensoQuest LabCycler 2.2 thermocycler (SensoQuest Biomedizinische Elektronik GmbH, Gottingen, Germany) for 35 cycles. After initial denaturation for 3 min at 95°C, each cycle consisted of denaturation at 94°C for 1 min, 45 s at the annealing temperature of the primer, 1 min extension at 72°C, with a final extension at 72°C for 10 min. The annealing temperature for each target genes is shown in Table 1. The PCR products were confirmed by agarose gel electrophoresis.
Following PCR, the amplified products were purified with the SanPrep column DNA gel extraction kit (Sangon Biotech), and then cloned directly into the PMD-19T vector (Takara) to facilitate DNA sequencing. All samples, including PCR products for polymorphism analysis, were sequenced by Sangon Biotech using the ABI-PRISM 3730 genetic analyzer (Applied Biosystems, Foster City, USA).
Sequence analysis. Resulting sequence chromato-grams were read with Chromas 2.33 software (Technelysium, South Brisbane, Australia). Sequences from S. mosellana were aligned using blastn and blastp (BLAST 2.0) with the sequences from M. destructor (GQ387648), R. pomum (GQ387649) and A. rosetta (GQ387650) [15] obtained from GenBank. Alignment was confirmed by visual inspection at both the nucleic acid and amino acid sequence levels. Nu-cleotide composition and number of transitions and transversions between species were determined using
Table 2. Mean nucleotide composition and variability information in mitochondrial protein-encoding genes of 4 Cecidomyiidae species
Gene Length A% T% G% C% (A + T)% V (%) S (%) Pi (%)
COX1 821 33.01 41.00 13.10 13.01 74.00 229 (27.89) 176 (21.44) 53 (6.46)
COX2 569 38.90 40.40 11.10 9.50 79.30 186 (32.69) 150 (26.36) 36 (6.33)
CytB 732 35.79 44.31 11.10 8.80 80.10 260 (35.52) 194 (26.50) 66 (9.02)
ND4 734 31.50 46.20 8.78 13.62 77.70 288 (39.24) 214 (29.16) 70 (9.54)
ND5 725 30.50 47.80 8.90 12.80 78.30 236 (32.55) 189 (26.07) 42 (5.79)
Notes: V, variable sites; S, singleton sites; Pi, parsimony informative sites.
MEGA 5 software [18]. Mean transition/transversion (ti/tv) ratio was calculated by MEGA 5 software. Possible saturation of these sequences was examined graphically by plotting the observed number of transitions/transversions against the uncorre
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.