MOXEKymPHÁa EHomma, 2012, moM 46, № 2, c. 224-233
TEHOMHKA. TPAHCKPHnTOMHKA
UDC 577.21;579.23"315
THE COMPLETE MITOCHONDRIAL GENOME OF SILVER CROAKER Argyrosomus argentatus (Perciforems; Sciaenidae): GENOME CHARACTERIZATION AND PHYLOGENETIC CONSIDERATION © 2012 Yuanzhi Cheng, Tianjun Xu*, Xiaoxiao Jin, Ge Shi, Rixin W&ng**
Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan, P.R. China, 316000 Received March 31, 2011 Accepted for publication July 05, 2011
The complete mitochondrial genome sequence of the silver croaker, Argyrosomus argentatus, was obtained by using LA-PCR and sequencing. The mitogenome is 16485 bp in length, consists of 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a non-coding control region like those found in other vertebrates, with the gene order similar to that of typical teleosts. Most of the genes of A. argentatus were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro)) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The origin of L-strand replication in A. argentatus was in a cluster of five tRNA genes (WANCY) and was 46 nucleotides in length. The conserved motif (5'-GCGGG-3') was found at the base of the stem within the tRNACys gene. Within the control region, we identified all of the conserved motifs except for CSB-F.
Keywords: Argyrosomus argentatus, complete mitochondrial genome, sciaenidae, control region.
The mitochondrial DNA (mtDNA) of vertebrates is a self-replicating, approximately 15—20 kb long, circular duplex molecule. It usually encodes 13 proteins, 22 transfer RNAs, and two ribosomal RNAs. Additionally, most of the determined vertebrate mtDNAs have a large non-coding region, highly variable in size and structure among same or different lineages, which contains signals for its replication and transcription [1,2]. Mainly because of its maternal inheritance, lack of recombination and an accelerated mutation rate compared to that of the nuclear DNA, the use of mtD-NA has become popular in phylogenetics studies, comparative and evolutionary genomics, population genetics and molecular evolution among various animal taxa [3, 4].
The silver croaker, Argyrosomus argentatus, is a benthonic oceanodromous fish that inhabits sandy or muddy bottoms in coastal inlets to a depth of 140 m. It is mainly distributed from Japan to the East China Sea, the Yellow Sea, the Bohai Sea and the Indo Pacific [5, 6]. The silver croaker is one of the major components of benthonic fish assemblages in coastal waters of China, supporting an important commercial fishery, thus several programs for investigation of the silver croaker have been launched with the aim of rational
* E-mail: tianjunxu@163.com; **wangrixin1123@126.com
utilization and resource management. Intensive studies have been performed in the areas of population dynamics, feeding habits, artificial incubation and reproductive cycle [7—9]. However, only a few studies concerning the genetic structure or phylogeny have been conducted on the silver croaker, and to date, there are no detailed studies on the characteristics of the complete mitochondrial genome of this species.
In this study, we present the complete nucleotide sequence for the mitochondrial genome of the silver croaker and determine its mitochondrial genomic structure. We also report on the organization, gene arrangement, and codon usage of silver croaker mitochondrial DNA and compare it to those of other Per-ciformes species. We expect that the present result will facilitate the further investigations of the molecular evolution of the Sciaenidae.
EXPRERIMENTAL
Sample collection and DNA isolation. Specimens of the silver croaker captured from the wild were obtained from a local fish market in China, and the whole tail fin was immediately preserved in 100% eth-anol. Mitochondrial DNA was extracted using the high-concentration-salt precipitation method [10] and kept at -20°C.
Table 1. Primers used in the amplifications
Primer Sequence (5'-3')
Dloop-F CACCCYTRRCTCCCAAAGCYA
Dloop-R GGTGCGGRKACTTGCATGTRTAA
COI-F AGTATAAGCGTCTGGGTAGTC
COI-R CCTGCAGGAGGAGGAGAYCC
LA-1F AAATCAAATAAGTGGTGACAGGCGAGAC
LA-1R GTAAATAGTGGGAATCAATGAACGAAGC
LA-2F GTGGGCGGACTGACAGGAATCGTATTAGC
LA-2R TGGGCTGTAGTTGTTCAAGTTGACGAGATG
Amplification and sequencing. Two pairs of universal primers (D-loop-F/R and COI-F/R) were used to amplify the segments of the control region and COI, respectively [11, 12]. 50 |L of the PCR mixture contained 0.2 |M of each primers, 5.0 |L of 10xTaq Plus polymerase buffer, 0.2 mM dNTPs, 2 unit of Taq Plus DNA polymerase with proof-reading characteristic ("TIANGEN"), and 1 |L of the DNA template. PCR was performed on a PTC-200. The PCR conditions were as follows: predenaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 50 s, annealing at 60°C for 60 s, extension at 72°C for 1 min; and a final extension at 72°C for 10 min. The PCR products were electrophoresed on a 1% agarose gel in order to check the integrity and visualized by the Molecular Imager Gel Doc XR system ("BioRad", USA). The PCR products were purified using a QIAE II Gel Extraction Kit ("Qiagen"). The purified fragments were ligated into PMD18-T vectors ("Takara") and transformed into T0P10 cells ("TIANGEN") according to the standard protocol. Positive clones were screened via PCR with M13(+/—)-primers. Amplicons were sequenced using an ABI 3730 automated sequencer with M13(+/-)-primers. To amplify the complete mitochondrial genome, two Pairs ofLA-PCR primers (LA-1F/1R and LA-2F/2R), designed basing on the sequence ofcon-trol region and the COI segments were used (Table 1). The amplified products were purified and then se-quenced directly. All of the obtained sequence fragments were edited in Sequencher™ (Gene Code, Ann Arbor, MI, USA) for a contig assembly to make the complete mitochondrial genome.
Sequence analysis. Annotation of protein-coding and ribosomal RNA (rRNA) genes and determination of their gene boundaries were carried out using reference sequences of the Sciaenidae available in the GenBank. Most tRNA genes and their secondary clover-leaf structures were identified in tRNAscan-SE1.21 [13]. The remaining tRNA genes, which could not be
found by tRNAscan-SE, were identified by sequence homology, secondary structures and specific anti-codons. Nucleotide base frequencies and codon usage of protein-coding genes were determined using MEGA 4 [14]. The complete mitochondrial genome (mitogenome) sequence of the silver croaker was deposited in the public database GenBank under accession number NC_015202.
RESULTS AND DISCUSSION Genome organization and structure
The complete nucleotide sequence of the L-strand of the silver croaker mtDNA was determined to be 16485 bp long, which is within the range of other te-leost mitogenomes, and consisted of 13 protein-coding genes, two ribosomal RNA genes (rRNAs), 22 transfer RNA genes (tRNA), and a putative control region (Table 2, Fig. 1). The mitochondrial genome structure of the silver croaker is very similar to those found in other vertebrates; both the protein-coding gene lengths and gene order in the mitogenomes are identical to previously reported patterns [15—21]. Specifically, the genes are similar in length to those found in other fish [22]. Also as in other vertebrates, most of the genes are encoded on the H-strand, and only the NADH dehydrogenase gene subunit (ND) 6 and eight tRNA genes (tRNAGln, tRNAAla, tRNAAsn, tRNACys, tRNATyr, tRNASer(UCN), tRNAGlu, and tRNAPro) are encoded on the L-strand. The silver croaker mitochondrial genes overlapped by a total of 38 bp in seven different locations with one to 20 bp long ovelaps. The mtDNA genome of the silver croaker also includes 13 intergenic spacers, ranging from 1 to 35 bp in length (69 bp in total), only one of which spans longer than 10 bp. Compared to the genes, the extent of the overlaps and spacers differs in the various fish mitochondrial genomes [23—25]. Analysis of the overall base composition (T: 26.3%; C: 30.2%; A:
Table 2. Characterizations of the mitochondrial genome of silver croaker, Argyrosomus argentatus
Gene Position Size, bp Codon Intergenic nucleotide** Strand
from to nucleotide amino acid initiation stop*
tRNAPhe 1 68 68 0 H
12S rRNA 69 1018 947 2 H
tRNAVal 1022 1094 73 1 H
16S rRNA 1096 2805 1710 0 H
tRNALeu(UUR) 2806 2879 74 0 H
ND1 2880 3851 972 323 ATG TAA 4 H
tRNAIle 3856 3925 70 0 H
tRNAGln 3926 3996 71 -1 L
tRNAMet 3996 4064 69 0 H
ND2 4065 5110 1046 348 ATG TA- 0 H
tRNATrp 5111 5181 71 0 H
tRNAAla 5182 5250 69 3 L
tRNAAsn 5254 5326 73 35 L
tRNACys 5362 5427 66 0 L
tRNATyr 5428 5497 70 1 L
CO1 5499 7055 1557 518 ATG AGA -5 H
tRNASer(UCN) 7051 7121 71 3 L
tRNAAsp 7125 7193 69 7 H
CO2 7201 7891 691 230 ATG T- 0 H
tRNALys 7892 7966 75 1 H
ATPase8 7968 8135 168 55 ATG TAA -1 H
ATPase6 8126 8809 684 227 ATG TAA 0 H
CO3 8809 9593 785 261 ATG TA- 0 H
tRNAGly 9594 9664 71 0 H
ND3 9665 10013 349 116 ATG T- 0 H
tRNAArg 10014 10082 69 0 H
ND4L 10083 10379 297 98 ATG TAA -7 H
ND4 10373 11753 1381 460 ATG T- 0 H
tRNAHis 11754 11822 69 0 H
tRNASer(AGY) 11823 11889 67 6 H
tRNALeu(CUN) 11896 11967 72 -20 H
ND5 11948 13789 1842 613 GTG TAA -4 H
ND6 13786 14307 522 172 ATG TAA 1 L
tRNAGlu 14309 14376 68 1 L
Cytb 14378 15518 1141 380 ATG T- 0 H
tRNAThr 15519 15590 72 4 H
tRNAPro 15595 15663 69 -15 L
Control region 15649 16485 836 H
* — TA- and T— represent incomplete stop codons. ** — Numbers correspond to the nucleotides separating adjacent genes. Negative numbers indicate overlapping nucleotides.
□ Complex I (NADH dehydrogenase)
□ Complex IV (cytochrome c oxidase) ATP synthase
a Other g
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.