ФИЗИОЛОГИЯ РАСТЕНИЙ, 2011, том 58, № 2, с. 268-274
ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ
УДК 581.1
THE ISOLATION AND ANALYSIS OF A SOYBEAN CO HOMOLOGUE GmCOLlO © 2011 L. Liu*, J. Ma**, Y. Han*, X. Chen**, Y.-F. Fu***
*State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing, China **College of Life Sciences, Henan Agricultural University, Zhengzhou, China ***Institute of Crop Sciences, National Key Facility of Crop Gene Resource and Genetic Improvement, Chinese Academy
of Agricultural Sciences, Beijing, China Received June 24, 2010
The CONSTANS (CO) gene is a key regulator of the response to photoperiod in the model plant Arabidopsis thaliana, and its homologues are present in many plant species. We describe here the isolation of the CO homologue for zinc finger protein gene GmCOLlO (Glycine max CONSTANS-Like 10) from the soybean cultivar Kennong18. Sequence comparisons showed that the closest A. thaliana gene to GmCOLlO is COL5. The expression of GmCOLlO was regulated in a circadian manner, especially under short-day conditions. The expression of GmCOLlO was concentrated in vegetative organs, and in particular in the unifoliolates and cotyledons. An analysis of subcellular localization found GmCOLlO in the nucleus. Our data suggested that GmCOLlO was not related to the photoperiodic pathway of floral transition as Arabidopsis CO does.
Keywords: Glycine max — CONSTANS — GmCOLlO — flowering — zinc finger protein
INTRODUCTION
In many plant species, development, in particular, the transition from vegetative to reproductive growth is heavily influenced by the length of the photoperiod. The genes involved in the photoperiod pathway [1] include photoreceptors, circadian clock sensors, and various downstream flowering genes. A prominent component of the pathway is the gene CONSTANS (CO). The switch from vegetative to reproductive growth is triggered when the level of CO expression reaches a threshold. When the CO expression reaches a suitable level at suitable time, it can induce flower initiation through florigen FLOWERING LOCUS T (FT) [2]. CO encodes a zinc-finger transcription factor containing two B boxes and one CCT (CO, CO-like, TOC1) domain [3]. It is a member of a small gene family, which in Arabidopsis thaliana comprises at least 17 members; these have been assigned to three distinct groups based on the number and structure of certain key domains [4, 5]. Following CO isolation from A. thaliana [3], it became clear that CO structural homologues were widespread in the plant kingdom [5—
1 These authors contributed equally to the work.
Abbreviations-. ACT11 - actin 11; CCT - CO, CO-like, TOC1; CO - CONSTANS; COL - CO-like; FT - FLOWERING LOCUS T; LD - long day; SD - short day; SKIP16 - SKP1/Ask-Interacting Protein 16; TUA5 - alpha-tubulin; UKN1 - hypothetical protein; ZT - Zeitgeber time.
Corresponding author. Yong-Fu Fu. Institute of Crop Sciences, National Key Facility of Crop Gene Resource and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing, 100081 China. E-mail. fuyf@caas.net.cn
9], and even in green algae [10]. All the presumed orthologues show circadian expression patterns and are able to rescue the A. thaliana CO mutant. When the Pharbitis nil (short-day plant) gene PnCO was overex-pressed in A. thaliana, it accelerated flowering both in the wild type and in the CO mutant under both long and short day conditions [7]; similarly BvCOLl isolated from the long-day Beta vulgaris complemented the late flowering phenotype of the A. thaliana CO-2 mutant under various photoperiods [11]. These findings indicate the existence of common mechanisms for CO function across the plant kingdom.
While the major activity of CO itself is to accelerate flowering under both long and short days, other members of this gene family affect development in different ways. Thus, for example, COL9 is involved in the regulation of flowering time through its inhibition of CO expression [12], COL3 is involved in the suppression of flowering, branching, root development, and anthocy-anin accumulation [13], COL5 is only active under short-day conditions [14], and neither COL1 nor COL2 have any effect on flowering time although overexpression of COL1 shortens the period of circadian rhythms in a fluence rate-dependent mode [15]. In rice, Hdl acts upon flowering time under long day by inhibiting Hd3a, a homologue of A. thaliana FLOWERING LOCUS T, but under short day it accelerates flowering [16]. The CO/FT module in Populus trichocarpa controls flowering as well as growth cessation and bud set in the fall [17]. The overexpression of CO impairs tuber formation in transgenic potato grown under short day [18]. Thus the members of the
CO gene family clearly have a wide-ranging effect over plant development.
Here, we report the isolation of a CO-like gene from soybean CONSTANS-like 10 (GmCOL1G) and present an analysis of its structure and expression profiles in circadian, developmental, and tissue-/organ-specific mode. Our data suggest that, as distinct from Arabidopsis CO, GmCOL10 is not related to the photoperiodic pathway of floral transition.
MATERIALS AND METHODS
Plant materials. All samples were harvested from soybean cultivar Kennong18 (Glycine max L., KN18), an important cultivar in northeast China. Soybean plants were grown in a growth room under either short-day conditions (SD, 8 h light/16 h dark) or long-day conditions (LD, 16 h light/8 h dark) under a light intensity of150 pmol/(m2 s) at a temperature of 28°C. Unifoliolate tissues were sampled at 2-h intervals over 96 h (two days of SD or LD photoperiod conditions and two days of continuous light or dark). Soybean plants were entrained in SD or LD photoperiod regime before they transferred into continuous light or dark conditions when the unifoliolates fully expanded. Seedlings were harvested before the expansion of the unifoliolate leaves (around 7 days after germination). Various tissues/organ samples were harvested when the unifoliolate, the first trifoliolate, the second trifoli-olate, the third trifoliolate, or the fourth trifoliolate opened fully, or when plants were in flowering. Seeds and pods without seeds were sampled at 7, 14, and 21 days after flowering, as well as at maturity. All samples were immediately frozen in liquid nitrogen and stored at —80°C until used.
RNA isolation and cDNA synthesis. Total RNA was extracted either by the TRIzol reagent ("Invitrogen") or by the CTAB method [19]. RNA quality was evaluated by monitoring absorbance spectrum. Only RNA preparations having an A260/A280 ratio of 1.8—2.0 and an A260/A230 ratio > 2.0 were used. First-strand cDNA synthesis was carried out using 4 pg RNA with the Re-vertAid first strand cDNA synthesis kit ("Fermentas") and oligo-dT primers.
Gene cloning and bioinformatics analysis. A cDNA fragment containing untranslational region (UTR) and coding sequence (cds) of Glyma13g01290.1 was amplified by RT-PCR with primers of GmCOL10F-F and GmCOL10F-R (table). Three independent clones were sequenced ("SunBio", China). Then the resulting consensus sequence was used as the template for the cds amplification with primers of GmCOL10C-F and GmCOL10C-R (table), and the cds was cloned into pGWC [20]. The resulting cds clone was confirmed by sequencing. The alignment was performed using MEGA V4.0.
Quantitative real time RT-PCR. Quantitative real time RT-PCR was carried out by an ABI StepOne De-
Primer sequences used in qRT-PCR and gene cloning studies
Name of primers Sequence (5' to 3')
GmCOLlOF-F TTCCACTCCTCGCAATAAGA
GmCOLlOF-R GCCGAAACTTGGCTTGGT
GmCOLlOC-F ATGGGAATTGAAAGAGGAGG
GmCOLlOC-R CTAAAACGTTGGTACGACACC
qGmCOLlO-F AGCACCACCACCAATCTG
qGmCOLlO-R ACCACTCCGACATCAAGC
GmACTIN11-F ATCTTGACTGAGCGTGGTTATTCC
GmACTIN11-R GCTGGTCCTGGCTGTCTCC
GmTUA5-F TGCCACCATCAAGACTAAGAGG
GmTUA5-R ACCACCAGGAACAACAGAAGG
GmSKIP16-F GAGCCCAAGACATTGCGAGAG
GmSKIP16-R CGGAAGCGGAAGAACTGAACC
GmUKNl-F TGGTGCTGCCGCTATTTACTG
GmUKNl-R GGTGGAAGGAACTGCTAACAATC
tection System ("Applied Biosystems"), based on SYBR Premix Ex Taq polymerase ("TaKaRa"). Each 15 pl reaction comprised 4 pl template, 7.5 pl 2 x SYBR Premix, 0.3 pl (200 nM) of each primer, and 0.3 pl ROX. The two primers were qGmCOL10-F and qGmCOL10-R (table). To increase the reliability, two of different reference genes were introduced for various samples according to [21]: SKIP16 and UKN1, for developmental samples; ACT11 and UKN1, for tissues/organs; ACT11 and TUA5, for photoperiod (SD/LD) samples. All primers are listed in the table. The data were automatically analyzed using the StepOne Software v. 2.0 according to the approach described by Hu et al. [21]. Each experiment was repeated at least three times.
Subcellular localization of GmCOL10 proteins. The
vector pGWC is an entry vector for gene cloning [20]. Therefore, a LR recombination reaction between pGWC-GmCOL10 and pENSG-YFP (a destination vector provided by Dr. Parker, Max Planck Institute, Cologne, Germany) was carried out with GATEWAY kit ("Invitrogen") according to the manual. The resulting vector pENSG-YFP-GmCOL10 was biolisti-cally co-transformed into onion epidermis cells with the vector of pENSG-CFP-AHL2, which served as a maker of nuclear proteins [22]. Transformation was achieved with the PDS 1000/He device ("Bio-Rad", United States), utilizing the following parameters: shot distance — 6 cm, vacuum — 25" Hg, rupture disc pressure — 1100 psi. YFP (yellow fluorescent protein) was monitored by a confocal microscopy (LEICA TCS SP2, Germany).
rf
0.6 0.5 0.4 0.3 0.2 0.1 0
Fig. 1. A protein sequence-based phylogeny of GmCOLlO and the A. thaliana CO family.
GmCOLlO is related to the A. thaliana CO family group I, and its most closely related member is AtCOL5. The classification of CO family in Arabidopsis is according to Robson et al. [4].
RESULTS GmCOLlO is closely related to AtCOL5
A Blast search of the soybean genome
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.