H
EHOOPrAHH^ECKAa XHMH3, 2012, moM 38, № 4, c. 477-481
THE REGULATION OF SILKWORM Fibroin L CHAIN PRODUCTION BY miRNA-965 AND miRNA-1926 IN INSECT CELLS © 2012 Yong Huang",b, Quan Zouc, Fei Song4, Xin Wang4, and Xing Jia Shenb #
aAnimal Science and Technology College, He Nan University of Science and Technology, Luoyang City,
471003, Henan Province, P.R. China bThe Key Laboratory of Silkworm and Mulberry genetic Improvement, Ministry of Agriculture, Sericultural Research Institute, Chinese Academy of Agricultural Sciences, Zhenjiang City, 212018, Jiangsu Province, P.R. China cSchool of information Science and Technology of Xiamen University, Xiamen city, 361005, Fujian Province, P.R. China Received September 18, 2011; in final form November 20, 2011
MicroRNAs (miRNAs) are an abundant class of approximately 22-nucleotide (nt)-short noncoding RNA molecules present in the genomes of all multicellular organisms that act through base pairing to partially complementary sequences of the 3'untranslated region (UTR) of targeted mRNAs. Using bioinformatic approach, we found that the 3'UTR of the Fibroin L chain (Fib-L) mRNA matches perfectly the nucleotides 2—8 at the 5' end of the miRNA-965 and miRNA-1926. These two miRNAs might act as regulators of Fib-L gene expression at the post-transcriptional level. To examine whether Fib-L is directly targeted by miRNA-965 and miRNA-1926 in vitro, miRNA expression vectors and target reporter vector with 3'UTR of Fib-L were constructed respectively. Two vectors were co-transfected into Sf21cells. The luciferase assay showed that miRNA-965 and miRNA-1926 may down regulate the expression of Fib-L via complementary interaction with the target sites in 3'UTR.
Keywords: silkworm, miRNAs, targets, functional identification.
INTRODUCTION
MicroRNAs (miRNAs) are 18—24 nucleotides non-coding small RNA molecules derived from a 70—90 nucleotides hairpin stem-loop pre-miRNA. The pre-miRNA is then recongnized by Dicer, and cleaved to produce a mature miRNA [1, 2]. The miRNAs are widely present in various eukaryotic organisms and play important roles in many biological processes as posttranscriptional regulators of gene expression [3—5]. Nowadays study of miRNAs is becoming one of the hotspots in biologcal research. Mature miRNAs recognize their target mRNAs by base-pairing interactions between nucleotides 2—8 (seed region) of the miRNA and the complementary nucleotides in the 3'untranslated region (3'UTR) of the mRNAs [6, 7]. miRNAs inhibit gene expression by targeting mRNAs for translation-al repression or cleavage [8, 9]. Increasing attention has thus been paid to their identification of their target genes. Identification of the miRNAs is an important step in elucidating the function of miRNAs. Previous studies indicated that potential targets can be validated experimentally using report gene assays [10-12].
# Corresponding author (fax: +86 (511) 856-22-507; e-mail: shenxj63@yahoo.com.cn).
The silkworm (Bombyx mori), an insect that undergoes complete metamorphosis, not only has great agronomic value but is also an excellent model for the study of insect genetics and molecular biology [13, 14]. The silk gland of silkworm is a very important organ where fibroin is synthesized and secreted [15, 16]. Studies confirmed that many regulators are involved in regulation of silk protein gene expression [17, 18]. Until now, little is known about the mechanism of regulation of gene expression in silk gland.
In this paper, by bioinformatic search for miRNAs potentially interacting with the 3'UTR of the Fib-L, we found that the silkworm miRNA-965 and miRNA-1926 are perfectly complementary to the target in seed region. Thus, these two miRNAs may be involved in the post-transcriptional regulation of the expression of the Fib-L. In order to check whether these two miRNAs may regulate the Fib-L gene expression the miRNAs expression vector and lu-ciferase gene-based reporter vector were constructed respectively. The activities of luciferase were shown to decrease significantly implying that miRNA-965 and miRNA-1926 down regulate the expression of Fib-L gene via complementary interaction with the target site in 3'UTR. These data provide the experimental bases for further studies of transcriptional regulation of Fib-L gene by miRNAs targeting.
478
YONG HUANG et al.
RNAhybrid prediction:
miRNA-965 target 5' u uu gga g 3'
gugu gcguua uuuuuuuug uaua cgcgau gaagagggc miRNA 3' g u auc 5'
miRNA-1926 target 5' g g u 3'
uuugcuuaggauuuuu aaacgaaucuuaagga miRNA 3' ggaa a 5'
RNA22 prediction:
miRNA-965 target 5' guguuugcguuagga uuuuuuuug III 11II111 11111111
miRNA 3' guau au-cgcgauaucgaagauuuc miRNA-1926 target 5' uguguuugcguuaggauuuuu
I II I I I II II II Mil
miRNA 3' ggaaaaacgaaaucuuaagga
Fig. 1. Prediction of miRNA-965 and miRNA-1926 with a putative miRNA target site in the 3'UTR of Fib-L by RNAhybrid and RNA22. miRNA seed pairings with target site are highlighted by black blod characters and the pairing of adjacent nucleotides is marked.
Fig. 2. Expression of green fluorescent protein in insect cells transfected with miRNA expression vectors. (a) Sf 21 cells transfected with pcDNA3/A3-EGFP-miRNA-965. (b) Sf 21 cells transfected with pcDNA/A3-EGFP-miRNA-1926.
1.2
л eu 1.0
Л JU 0.8
0.6
£
0.4
и» > 0.2
JB eu a 0
I I
¿1 (JL Z
' Q
<2 u
3 +
I ^
on + Рч
J ^ Ь
0 pÎO
a
^T n i
•ss 3
^ a S
3 + P^
0 & S
ft5M
Fig. 3. Effect of miRNA expression on luciferase activity in transfected Sf21 cells. Data are represented as the mean value ± SD from three independent experiments.
RESULTS
Prediction of Silkworm miRNAs Targeting 3'UTR ofFib-L Gene
In order to explore whether any potential miRNAs associated with the Fib-L gene can be found, we utilized the RNA22 and RNAhybrid prediction software to predict the miRNAs which may target 3'UTR of Fib-L gene. As a result, the 2 miRNA candidates (miRNA-965 and miRNA-1926) were obtained. The two miRNAs recognize their target by base-pairing interactions between nucleotides 2—8 (seed region) and complementary nucleotides in 3'UTR of Fib-L (Fig. 1).
Expression of miRNA in Insect Cells
At forty-eight h post-transfection with the vectors (pcDNA3/A3-EGFP-miRNA-965 and miRNA-1926), a fluorescence signal was detected in the most of the cells. EGFP could be observed under a fluorescent microscope, showing the successful expression of EGFP (Fig. 2). Since genes of miRNA-precursors are inserted into the 3'-region of EGFP gene they should be expressed as well in Sf21 cells. Previous studies con-
firmed that EGFP marker gene placed at the 5'end of the miRNA expression cassette is expressed along with the mature miRNAs as was shown by northern blot assay [19-21].
Identification of miRNAs Targeting Fib-L Gene
The interaction of these miRNAs and potential Fib-L target in Sf21 cells were tested. As illustrated in Figure 3 (p < 0.05), in cells transfected with Fib-L 3'UTR reporter constructs and miRNA-965 or miRNA-1926 expression vector, the luciferase activity was repressed by 50 and 40% (miRNA-965 and miRNA-1926), respectively.
Luciferase activities of two positive controls were not significantly altered. Our results indicated that miRNA-965 and miRNA-1926 down regulate the expression of Fib-L gene via complementary interaction with the target site in 3'UTR of mRNA. Thus, we conclude that Fib-L is likely a direct target of miRNA-965 and miRNA-1926.
DISCUSSION
In plants, the miRNAs often show perfect or near-perfect complementarity with its target, resulting in target degradation, whereas animal miRNAs form imprecise base-pairing and cause translational repression. Identification target genes that miRNAs regulated by miRNAs is important for understanding their specific biological functions. Experimental validation of targets is currently done through in vitro reporter assays [19, 22-24]. For example, luciferase or enhanced green fluorescent protein (EGFP)-based reporter assay in cell, in which the entire 3'UTR of the putative target gene is cloned downstream of reporter gene, after the introduction of a miRNA to the cell, has been used for rapid detection of miRNA-target interaction in vitro. Previous studies showed that constructing miRNA expression vector is highly flexible and reliable with the insertion sequence of miRNA precursors and will facilitate the application of miRNA in functional targets research. Using eukaryotic vector to expressing miRNAs is considered to suppress target genes in vitro because insertion of precursor miRNA allows it to be processed in a similar biogenesis pathway similar as to that of the natural miRNA in vivo which results in functional mature miRNAs.
Increasing attention has thus been paid to their regulation mechanisms and the identification of target genes [25, 26]. Recently, Cao et al. using the heterologous (gus) reporter gene expression system by Agrobacteri-um-mediated method have also confirmed that at least 4 miRNAs (miRNA-33, miRNA-190, miRNA-276, and miRNA-7) might play an important role in the regulation ofFib-L expression [27]. It was also reported for the first time that miRNAs can regulate target Fib-L in the silkworm. Between miRNA and regulated target were both one-to-many and many-to-one relationships. We speculate that there are still other miRNAs which may regulate Fib-L gene. In this paper, by bioinformatic analysis using RNA22 and RNAhybird target prediction software, two candidate miRNA (miRNA-965 and miRNA-1926) targeting Fib-L was identified. To validate that 3'UTR of Fib-L is a functional target of these two miRNAs, we constructed miRNA expression vectors and reporter vector containing the 3'UTR of Fib-L at the 3'position of the luciferase gene. The recombinant vectors were co-transfected into Sf21 cells and relative luciferase activity were measured. It was shown that activity of lu-ciferase was significantly decreased and was not affected by other endogenous miRNAs. Overall, the current stu
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.