научная статья по теме ВЛИЯНИЕ МУТАЦИЙ И МОДИФИКАЦИЙ АМИНОКИСЛОТНЫХ ОСТАТКОВ НА ЦИНКИНДУЦИРОВАННОЕ ВЗАИМОДЕЙСТВИЕ МЕТАЛЛСВЯЗЫВАЮЩЕГО ДОМЕНА -АМИЛОИДА С ДНК Биология

Текст научной статьи на тему «ВЛИЯНИЕ МУТАЦИЙ И МОДИФИКАЦИЙ АМИНОКИСЛОТНЫХ ОСТАТКОВ НА ЦИНКИНДУЦИРОВАННОЕ ВЗАИМОДЕЙСТВИЕ МЕТАЛЛСВЯЗЫВАЮЩЕГО ДОМЕНА -АМИЛОИДА С ДНК»

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ, 2015, том 49, № 3, с. 507-514

СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЙ АНАЛИЗ ^^^^^^^^ БИОПОЛИМЕРОВ И ИХ КОМПЛЕКСОВ

УДК 577.112.7

ВЛИЯНИЕ МУТАЦИЙ И МОДИФИКАЦИЙ АМИНОКИСЛОТНЫХ ОСТАТКОВ НА ЦИНКИНДУЦИРОВАННОЕ ВЗАИМОДЕЙСТВИЕ МЕТАЛЛСВЯЗЫВАЮЩЕГО ДОМЕНА р-АМИЛОИДА С ДНК

© 2015 г. С. А. Хмелёва1, Ю. В. Мезенцев1,2, С. А. Козин2, В. А. Митькевич2, А. Е. Медведев1,2, А. С. Иванов1, Н. В. Бодоев1, А. А. Макаров2, С. П. Радько12*

Научно-исследовательский институт биомедицинской химии им. В.Н. Ореховича, Москва, 119121 2Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук, Москва, 119991

Поступила в редакцию 07.10.2014 г.

Принята к печати 20.10.2014 г.

Взаимодействие внутриклеточного р-амилоида с ДНК считается одним из возможных механизмов патогенеза болезни Альцгеймера. С использованием метода поверхностного плазмонного резонанса проанализировано взаимодействие двух- и одноцепочечной ДНК с синтетическими пептидами, представляющими металлсвязывающий домен р-амилоида (аминокислотные остатки 1—16) и его варианты с химической модификацией аминокислотного остатка и точечными аминокислотными заменами, ассоциированными с повышенной нейротоксичностью р-амилоида в клеточных тестах. Установлено, что присутствие ионов цинка необходимо для взаимодействия пептидов с ДНК в растворе. Замена H6R приводила к существенному снижению способности домена 1—16 связываться с ДНК. Это находится в согласии с предположением, что координация иона цинка остатками His6, Glu11, His13 и His14 этого домена вызывает появление анионсвязывающего сайта, ответственного за взаимодействие домена с ДНК. Цинк-индуцированная димеризация и олигомеризация домена 1—16, связанная с фосфорилиро-ванием Ser8 или наличием свободных амино- и карбоксиконцевых групп, приводила к уменьшению концентрации пептидов, при которой наблюдалось взаимодействие пептид-ДНК. Наличие у этих димеров и олигомеров множественных анионсвязывающих сайтов ответственно за усиление взаимодействия пептида с ДНК. Замена отрицательно заряженного остатка Asp7, находящегося в непосредственной близости к анионсвязывающему сайту домена 1—16 Ар, на нейтральный остаток Asn способствует электростатическому взаимодействию этого сайта с фосфатами полинуклеотидной цепи и усилению тем самым цинкиндуцированного связывания с ДНК.

Ключевые слова: болезнь Альцгеймера, р-амилоид, ДНК, цинк, биосенсорный анализ.

EFFECT OF MUTATIONS AND MODIFICATIONS OF AMINO ACID RESIDUES ON ZINC-INDUCED INTERACTION OF THE METAL-BINDING DOMAIN OF p-AMYLOID WITH DNA, by S. A. Khmeleva1, Y. V. Mezentsev1'2, S. A. Kozin2, V. A. Mitkevich2, A. E. Medvedev1'2, A. S. Ivanov1, N. V. Bodoev1, A. A. Makarov2, S. P. Radko1' 2* (1Orekhovich Institute of Biomedical Chemistry, Moscow, 119121 Russia; *e-mail: radko@ibmc.msk.ru; 2Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia). Interaction of the intra-nuclear p-amyloid with DNA is considered as a plausible mechanism of Alzheimer's disease pathogenesis. Using the method of surface plasmon resonance, the interaction of single- and double-stranded DNA with synthetic peptides was analyzed. The peptides represent the metal-binding domain of p-amyloid (amino acids 1—16) and its variants with the chemical modification and the point substitutions of amino acid residues, which are associated with the enhanced neurotoxicity of p-amyloid in cell tests. It has been shown that the presence of zinc ions is necessary for the interaction of the peptides with DNA in solution. Substitution H6R has remarkably reduced the ability of domain 1—16 to bind DNA. This agrees with the suggestion that the coordination of zinc ion by amino acid residues His6, Glu11, His13, and His14 of the p-amyloid's metal-binding domain results into occurrence of an anion-binding site responsible for the interaction of the domain with DNA. Zinc-induced dimerization and oligomerization of domain 1—16, associated with phosphorylation of Ser8 and the presence of unblocked amino and carboxyl terminal groups have resulted into a decrease of peptide concentrations required to detect the peptide-DNA interaction. The presence of multiple anion-binding sites on the dimers and oligomers is responsible for the enhancement of the pep-tide-DNA interaction. Substitution of the negatively charged residue Asp7 with the neutral residue Asn in a

* Эл. почта: radko@ibmc.msk.ru

proximity of the anion-binding site of the domain 1—16 of Ap facilitates the electrostatic interaction of this site with phosphates of a polynucleotide chain thus enhancing zinc-induced binding to DNA.

Keywords: Alzheimer disease, p-amyloid, DNA, zinc, biosensor analysis. DOI: 10.7868/S0026898415020068

Болезнь Альцгеймера (БА) — наиболее распространенное нейродегенеративное заболевание, которым страдают десятки миллионов человек в мире, однако молекулярные механизмы патогенеза БА остаются неясными. Согласно одной из основных гипотез ключевую роль в возникновении и развитии БА играет Р-амилоид — пептид, состоящий из 39—43 аминокислотных остатков (AP) [1]. Ap может аккумулироваться внутри нейронов [2—4], причем предполагается, что накопление внутриклеточного Ар предшествует формированию сенильных бляшек при БА [5]. Опубликовано значительное число работ, выполненных на трансгенных мышах (суммированы в [6]), в которых выявлена связь между накоплением Ар в нейронах и их гибелью. Это позволило выдвинуть гипотезу, согласно которой именно накопление внутриклеточного Ар является первичным событием патогенеза БА [7—9]. Внутри нейронов Ар находят в различных органеллах [10], в том числе в клеточном ядре [11, 12]. Известно, что накопление Ар в клеточном ядре стимулируется окислительным стрессом [13, 14]. Однако и в отсутствие окислительного стресса Ар может проникать внутрь ядра [15] и взаимодействовать там с ДНК [13, 14]. Предполагается, что это взаимодействие может привести к нежелательным изменениям экспрессии ДНК и, в конечном итоге, к гибели нейронов [16].

Взаимодействие Ар с ДНК in vitro описано в многочисленных работах [13, 17—21]. Известно, что Ар вызывает изменения во вторичной [20] и третичной (суперспирализация) [18] структуре ДНК, а также способствует конденсации молекул ДНК [17]. Связывание Ар с ДНК зависит от нуклеотидной последовательности [13, 19], т.е. Ар предпочтительнее связывается со структурами определенной последовательности и, по-видимому, может действовать как фактор транскрипции [22].

Ионы цинка формируют стабильные комплексы с Ар посредством взаимодействия с аминокислотными остатками, расположенными в металл-связывающем домене пептида — N-концевом участке, состоящем из 16 аминокислотных остатков [23]. Известно, что цинк играет важную роль в агрегации Ар и вовлечен в патогенез БА [23]. Однако неясными остаются большинство аспектов, связанных с влиянием ионов цинка на взаимодействие Ар с ДНК.

Ранее мы показали, что домен 1—16 является цинкзависимым ДНК-связывающим сайтом Ар

[24]. Известны точечные замены аминокислотных остатков в этом домене, ассоциированные с ранним началом БА — D7N и H6R (мутации "Тот-тори" и "английская" соответственно [25]), а также такая посттрансляционная модификация, как фосфорилирование Ser8 [26]. Как замены D7N и H6R, так и фосфорилирование Ser8 приводят к повышенной нейротоксичности Aß в клеточных тестах [25, 26]. Для выяснения влияния мутаций и посттрансляционной модификации Aß на опосредованное цинком взаимодействие его ме-таллсвязывающего домена с ДНК мы проанализировали методом поверхностного плазмонного резонанса связывание синтетических пептидов, соответствующих интактной и измененным формам домена 1—16, с оц- и дцДНК в присутствии ионов цинка.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Материалы. В работе использовали синтетические пептиды Aß 16* с "открытыми" концами (NH2-DAEFRHDSGYEVHHQK-COOH), Aß16 с "закрытыми" концами (ацетил-DAEFRHDS-GYEVHHQK-амид, пептид с ацетилированным и амидированным концами), а также такие его модификации, как pS8-Aß16 (содержит фосфо-рилированный остаток Ser8), D7N-Aß16 и H6R-Aß16 (замены остатков Asp и His на остатки Asn и Arg соответственно). Пептиды были синтезированы компанией "Biopeptide" (San Diego, США) и имели чистоту >95%, как определено методом ВЭЖХ на обращенной фазе. Аминокислотная последовательность пептидов была подтверждена анализом на масс-спектрометре ионного циклотронного резонанса с преобразованием Фурье 7T Apex Qe ("Bruker Daltonics", США). Лиофилизо-ванные пептиды хранили при -20°C.

Олигонуклеотиды синтезировали на ДНК-синтезаторе ASM-800 ("Биоссет", Новосибирск, Россия), 5'-концевое биотинилирование проводили в процессе синтеза. Детали синтеза и очистки олигонуклеотидов описаны ранее [24].

Оптические чипы SA с ковалентно присоединенным к поверхности стрептавидином были приобретены в компании "GE Healthcare" (США). Реагенты, использованные для синтеза и очистки оли-гонуклеотидов, поставлены компаниями "Acros Organics" (Бельгия) и "Glen Research" (США). Остальные реактивы были приобретены в компании "Sigma-Aldrich" (США) и имели чистоту, соот-

ветствующую "х.ч." или выше. Для приготовления растворов использовали деионизованную воду, полученную на установке Milli-Q ("Millipore", США).

Приготовление препаратов дцДНК. Фрагменты дцДНК длиной 75 п.н. со случайной областью (далее rDNAf, "random" DNA fragments) были получены путем ПЦР-амплификации комбинаторной библиотеки олигонуклеотидов, содержащих участок со случайной последовательностью длиной 32 н. (5' - GGGAGCTCAGAATAAACGCTCAA— (dN)32-TTCGACATGAGGCCCGGATC-3'), с использованием 5'-биотинилированного прямого праймера (биотин-5'-GGGAGCTCAGAATAAAC-GCTCAA-3'). Получение и очистка олигонуклеотидов и фрагментов ДНК описаны ранее [24]. Дуплекс поли(dA) • поли^Т) (далее pAT) готовили, смешивая олигонуклеотиды поли(dA)75 с 5'-биотини-лированными олигонуклеотидами поли(dT)75 как описано ранее [24].

Биосенсорный анализ. Взаимодействие пептидов с ДНК анализировали с помощью оптического биосенсора Biacore 3000 ("GE Healthcare", США), работающего на принципе поверхностног

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»