научная статья по теме BRASSICA NAPUS POSSESSES ENHANCED ANTIOXIDANT CAPACITY VIA HETEROLOGOUS EXPRESSION OF ANTHOCYANIN PATHWAY GENE TRANSCRIPTION FACTORS Биология

Текст научной статьи на тему «BRASSICA NAPUS POSSESSES ENHANCED ANTIOXIDANT CAPACITY VIA HETEROLOGOUS EXPRESSION OF ANTHOCYANIN PATHWAY GENE TRANSCRIPTION FACTORS»

ФИЗИОЛОГИЯ РАСТЕНИЙ, 2013, том 60, № 1, с. 97-104

ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ

УДК 581.1

Brassica napus Possesses Enhanced Antioxidant Capacity via Heterologous Expression of Anthocyanin Pathway Gene Transcription Factors1 © 2013 X. Nie*, 2, Z. P. Zhao*, **, 2, G. P. Chen*, B. Zhang*, M. Ye*, Z. L. Hu*, 2

*Bioengineering College, Chongqing University, Chongqing, P.R. China **School of Chemistry and Pharmaceutical Engineering, Sichuan University of Science & Engineering, Zigong, P.R. China

Received March 20, 2012

Anthocyanins are one of the largest and most important groups of water-soluble pigments in most species in the plant kingdom. They are flavonoid derivatives and colorful pigments of plant tissues and vegetables. Moreover, anthocyanins exhibit potential antioxidant capacity and can protect plants against biotic and abiotic stresses. In the present study, two transcription factor genes of the anthocyanin biosynthesis pathway, DELILA (Del) and ROSEAL (Rosl), were cloned from snapdragon Antirrhinum majus and heterologously expressed in Brassica napus. Down-stream structural genes in the anthocyanins biosynthesis pathway were significantly up-regulated. Furthermore, the anthocyanin content in the transgenic plant leaves was increased nearly up to tenfold and the antioxidant activity in transgenic leaves was approximately enhanced up to threefold. Our present study provides a novel approach to enhance B. napus antioxidant activity. Moreover, the present study supplies a potential source to produce anthocyanins from the tissues of transgenic Del/Rosl B. napus plant and yields a new insight into better understanding of the transcriptional regulation of anthocyanin biosynthesis.

Keywords: Brassica napus - anthocyanin - Delila - Roseall - antioxidant activity

DOI: 10.7868/S0015330313010041

INTRODUCTION

Secondary metabolism is an integral part of the developmental program of all plants and also a protective mechanism for plants to grow under biotic and abiotic stress conditions [1]. Flavonoids are ubiquitous plant secondary products [2], which play multiple roles in the responses of higher plants to a wide range of environmental constraints [3], in photoprotection [4], and as early proposed as developmental regulators [5]. An-thocyanins are one of the largest and most important groups of water-soluble pigments of flavonoid derivatives. They are responsible for red, blue, pink, scarlet, and purple pigmentation of plant tissues [6]. Recently, anthocyanins have been recognized for their health benefits due to their antioxidant capacity [7] and anti-mutagenic [8] and chemopreventive activities [9]. Research suggests that anthocyanin-containing food can inhibit cell mutation, reduce chemically induced col-

1 This text was submitted by the authors in English.

2 These authors contributed equally to this work.

Abbreviations'. ABTS - 2,2'-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid); AS - acetosyringone; BA - 6-benzyladenine; Cef -cefotaxime sodium; IBA - indole-3-butyric acid; Km - kanamy-cin; ZT - zeatin.

Corresponding author. Hu Zong Li. Bioengineering College, Chongqing University, Chongqing 400044, P.R. China. Fax. +8623-6511-2674, e-mail. huzongli@cqu.edu.cn

orectal carcinogenesis, prevent obesity and diabetes [10], and provide protection against cardiovascular disease and certain cancer [11]. In addition, regular consumption of anthocyanins has no apparent adverse effects on human health [12]. Therefore, more and more researchers have been attracted and considerable attentions have been paid to the biosynthesis and regulation of anthocyanin metabolism due to their health benefits.

Anthocyanin biosynthesis has been extensively studied [13], and a number of anthocyanin regulatory and structural genes have been isolated from several plant species (e.g., cabbage, maize, grape, pear, petunia, and snapdragon). Generally, transcription factors appear to contribute mainly to regulate anthocyanin biosynthesis through the regulation of structural genes [1]. In all plant species analyzed to date, the R2R3-MYB, basic helix-loop-helix (bHLH), and WD40 repeat proteins are the three most important and well characterized families of anthocyanin regulatory proteins [14]. MYB transcription factors possess its characteristic so-called N-terminal MYB domain, comprised of 1 to 3 imperfect repeats of almost 52 amino acids and closely related to DNA binding and dimer-ization [15]. For example, PAP1 is the most important components of MYB family and its expression could greatly enhance the anthocyanin levels and change the

N K

LB —^ 35S P \ Del 35S T —y 35S p \ Ros 1 35S T RB

1/ V

Fig. 1. Expression vector pBIN19-Del-Ros1 used in this study.

The two transcription factors were both driven by the CaMV 35S promoter separately.

Fig. 2. Phenotypes of Del/Rosl transgenic plants.

a - transgenic calli grown in callus medium; b - nontransgenic calli grown in callus medium; c - buds produced by transgenic calli; d - buds produced by transgenic calli; e-h - Del/Rosl transgenic plants grown on root-generation medium; i, j - completely purple leaf with purple leaf veins and leaf stalk.

color of plant [16]. As for bHLH transcription factors, experimental results suggest that the bHLH proteins can bind DNA either alone or as a dimer with MYB, depending on the type of promoter. Generally, the first N-terminal 200 amino acids of bHLH proteins interact with the MYB transcription factor, and the following 200 amino acids interact with WD40 proteins. The bHLH domain itself and the C-terminal regions are

involved in homodimer or heterodimer formation [17]. Moreover, WD40 proteins appear not to be involved in DNA binding or regulation of target gene expression; they can serve as a docking platform supplier supporting the interactions between MYB and bHLH proteins. Studies showed that MYB, bHLH, and WD40 proteins are often organized into a ternary complex, MYB-bHLH-WD40 (MBW), to regulate

Primers and sequences used in this study

Primer Sequence

Del-F1 5'-GAAGATCTGTAGAGAGGAGAGAGGATTCAAGAATG GCTACTGGTATCCAAAACC- 3'

Del-R1 5'-AAGATCTAGCCCTGCAAATTACTTAGC-3'

Ros1-F1 5 ' - GAAGATCTGTAGAGAGGAGAGAGGATTCAAGATGG AAAAGAATTGTCGTGGAGTG- 3 '

Ros1-R1 5'-GAAGATCTTTAATTTCCAATTTGTTGGGCCTCC-3'

Del-F2 5'-GTTGGTTCTTGGTCCCT-3'

Del-R2 5'-ATTTCATCAGCCGTTGG-3'

Ros1-F2 5 '-GATTGCACGTTACTTGGC-3'

Ros1-R2 5 '-AATTGCGTTTGCTTCTCAC-3'

C4H-F 5'-GCCGTTCCTTAGAGGCTACTTG-3'

C4H-R 5 '-CCTTGTTGATTTCTCCCTTCTGTT-3'

CHS-F 5'-GGCAAAGAGGCGGCAGTG-3'

CHS-R 5'-CGGAAGGACAAAGACCAAGGAG-3'

F3H-F 5'-TGAGAAAAGCCCAAGAAGAGC-3'

F3H-R 5'-TGGTGGATGGAGCCTGAAAT-3'

DFR-F 5'-GGGTTTTCTCCCTGTCACTTTAC-3'

DFR-R 5'-GCCATCCCTGGTTCGGTC-3'

ANS-F 5'-ATTACCCGAAATGCCCTCAG-3'

ANS-R 5'-ATTACCCGAAATGCCCTCAG-3'

UFGT-F 5'-TGAATGATGGGTGTATGGAGGA-3'

UFGT-R 5'-TCGGCACGAGGTAAAGCAA-3'

Actin-F 5'-GGAACTGGAATGGTGAAGGCTG-3'

Actin-R 5'-GTCTTTTTGACCCATCCCAAC-3'

flavonoid gene expression, and two MBW complexes, TT2/TT8/TTG1 and AN2/AN1/AN11, were characterized [14].

Additionally, anthocyanin biosynthesis is also under the control of environmental factors. It has been reported that sunlight, UV, and cold stress could up-regulate the anthocyanin biosynthesis in some fruits, but with unknown mechanisms [14]. On the other hand, the biosynthesis of anthocyanins varies markedly depending on the fruit development stages [18, 19].

Brassica napus is an oilseed crop and widespread all over the world. It is an important economic crop not only because its oil is useful to human health, but also because it contains antioxidants and phenolics in leaves [20]. However, limitations exist when employing B. napus as a source of anthocyanin. On the other hand, two transcription factors, Del and Ros1, belonging to bHLH and MYB transcriptional factors, respectively, discovered in snapdragon Antirrhinum ma-jus, were reported to possess the ability to up-regulate anthocyanin synthesis [21]. Therefore, we try to heter-ologously express the two transcription factor genes Del and Rosl in B. napus under the control of the CaMV 35S promoter to increase its anthocyanin con-

tent and subsequently enhance its antioxidant activity. As we have expected, the two transcription factors significantly up-regulated structural genes in the anthocyanin biosynthesis pathway measured by real-time PCR. Furthermore, the anthocyanin content in trans-genic plants was significantly increased and the anti-oxidant activity was dramatically enhanced. Our present study provides a novel approach to enhance B. napus antioxidant activity. Moreover, this study supplies a potential source to produce anthocyanins from the tissues of transgenic Del/Rosl B. napus plants and yields a new insight into better understanding of the transcriptional regulation of anthocyanin biosynthesis.

MATERIALS AND METHODS

Plant materials. Brassica napus bred by Chongqing Rapeseed Technology Research Center were grown in experimental field under traditional cultivation conditions and used for the transformation experiments. Seeds were immersed in water for 1-2 h and subsequently submerged in 95% ethanol for 1 min. They were then rinsed three times in sterilized dH2O, submerged in 0.1% mercuric chloride for 6-10 min, and

®H3HO.roraH PACTEHHH TOM 60 № 1 2013

7*

0.10 0.08

S 0.06

ca ^

o

o £

ö

ca

0.04 0.02 0.

rP

\

n>

O

^

o ^ wT

o

sr

cf

p0

Fig. 3. Total anthocyanin content in B. napus plants. The anthocyanin levels in the two independent transgenic plants OxDel/Ros1-Z1 and OxDel/Ros1-Z2 were tenfold more than that in nontransgenic plants OxDel/Ros1-L.

later germinated in the dark on MS agar medium for 2 days at 26°C. After germination in the dark, they were cultivated under light (2000 lx) for 16 h per day for 78 days. After that, hypocotyls were cut and used as explants. Snapdragons Antirrhinum majus was purchased from Chongqing Tianzi Flower.

Construction of expression vector. Total RNA was isolated from snapdragon A. maj

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»