научная статья по теме ФУНКЦИОНАЛЬНАЯ ХАРАКТЕРИСТИКА ДВУХ НОВЫХ МУТАЦИЙ СПЛАЙСИНГА В ГЕНЕ ГЛЮКОКИНАЗЫ ПРИ МОНОГЕННОМ ДИАБЕТЕ MODY2 Биология

Текст научной статьи на тему «ФУНКЦИОНАЛЬНАЯ ХАРАКТЕРИСТИКА ДВУХ НОВЫХ МУТАЦИЙ СПЛАЙСИНГА В ГЕНЕ ГЛЮКОКИНАЗЫ ПРИ МОНОГЕННОМ ДИАБЕТЕ MODY2»

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ, 2014, том 48, № 2, с. 288-294

ГЕНОМИКА.

ТРАНСКРИПТОМИКА

УДК 577.21

ФУНКЦИОНАЛЬНАЯ ХАРАКТЕРИСТИКА ДВУХ НОВЫХ МУТАЦИЙ СПЛАЙСИНГА В ГЕНЕ ГЛЮКОКИНАЗЫ ПРИ МОНОГЕННОМ ДИАБЕТЕ MODY2

© 2014 г. Е. Л. Игудин1,2, П. В. Спирин1, В. С. Прасолов1,2, Н. А. Зубкова3, Е. Е. Петряйкина4, А. Н. Тюльпаков3, П. М. Рубцов1,2*

Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук, Москва, 119991 2Московский физико-технический институт (государственный университет) (МФТИ), Долгопрудный, Московская обл., 141700 3Эндокринологический научный центр, Москва, 117036 4Морозовская детская клиническая больница, Москва, 119049 Поступила в редакцию 20.09.2013 г.

Принята в печать 16.10.2013 г.

Идентифицированы две новые мутации в гене глюкокиназы (GCK): замена G на C в положении —1 акцепторного сайта сплайсинга интрона 7 (c.864-1G>C) и синонимическая замена c.666C>G (GTC>GTG, p.V222V) в 6-м экзоне — у больных с моногенной формой диабета MODY2 (Maturity Onset Diabetes of Young). Сконструированы минигены GCK, содержащие эти мутации. Анализ продуктов сплайсинга ми-нигенов GCK после трансфекции клеток почки эмбриона человека линии HEK293 показал, что каждая из этих замен нарушает нормальный сплайсинг. В результате мутации c.864-1G>C блокируется использование нормального акцепторного сайта сплайсинга, что сопровождается активацией криптических акцепторных сайтов сплайсинга в интроне 7 и образованием нескольких аберрантных форм РНК, содержащих фрагменты интрона 7. Синонимическая замена ^666C>G создает новый донорный сайт сплайсинга в экзоне 6, что ведет к образованию дефектной мРНК глюкокиназы с 16-нуклеотидной де-лецией в экзоне 6. Анализ сплайсинга минигенов in vitro подтверждает инактивирующее действие новых мутаций на экспрессию глюкокиназы.

Ключевые слова: диабет МОБУ2, ген глюкокиназы, мутации сплайсинга, экспрессия минигенов, крип-тические сайты сплайсинга, аберрантные продукты сплайсинга, опосредуемая нонсенс-кодоном деградация мРНК.

FUNCTIONAL CHARACTERIZATION OF TWO NOVEL SPLICING MUTATIONS IN GLUCOKI-NASE GENE IN MONOGENIC DIABETES MODY2, by E. L. Igudin12, P. V. Spirin1, V. S. Prassolov12, N. A. Zubkova3, E. E. Petryaikina4, A. N. Tiulpakov3, P. M. Rubtsov12* (1Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia, *e-mail: rubtsov@eimb.ru; 2Moscow Institute of Physics and Technology (State University), Dolgoprudny, Moscow Region, 141700 Russia; Endocrinological Research Center, Moscow, 117036 Russia; 4Morozov Children's Hospital, Moscow, 119049 Russia). Two novel mutations in glucokinase (GCK) gene — G to C substitution at —1 position of intron 7 acceptor splice site (c. 864-1G>C) and synonymous substitution c. 666C>G (GTC>GTG, p.V222V) in exon 6 — were identified in patients with monogenic diabetes MODY2 (Maturity Onset Diabetes of Young). GCK minigenes with these mutations were constructed. Analysis of splicing products upon transfection of minigenes into human embryonic cell line HEK293 has shown that each of these nucleotide substitutions impair normal splicing. Mutation c.864-1G>C blocks the usage of normal acceptor site which activates cryptic acceptor splice sites within intron 7 and generates aberrant RNAs containing the portions of intron 7. Synonymous substitution c.666C>G creates novel donor splice site in exon 6 that leads to formation of defective GCK mRNA with deletion of 16 nucleotides of exon 6. Analysis of in vitro splicing of minigenes confirms the inactivating action of novel mutations on glucokinase expression.

Keywords: diabetes MODY2, glucokinase gene, splicing mutation, expression of minigenes, cryptic splice-sites, aberrant products of splicing, nonsense-mediated mRNA decay.

DOI: 10.7868/S0026898414020074

* Эл. почта: rubtsov@eimb.ru

Заболеваемость сахарным диабетом приобретает в последние годы характер пандемии и рассматривается как одна из наиболее серьезных угроз, стоящих перед человечеством в XXI веке. Высокая медико-социальная значимость диабета объясняется быстрым ростом заболеваемости, ранней инвалидизацией и высокой смертностью от связанных с диабетом осложнений. Среди важных достижений в изучении этиопатогенеза сахарного диабета за последние двадцать лет следует, безусловно, отметить выявление моногенных форм, которые по разным данным составляют 5—10% от всех случаев заболевания. К данной группе, прежде всего, относится так называемый сахарный диабет взрослого типа у молодых — MODY (от английского "Maturity Onset Diabetes of Young) [1, 2]. MODY — аутосомно-доминант-ная форма диабета, обычно проявляющаяся в возрасте до 25 лет и, в основном, вызываемая нарушениями в секреции инсулина. MODY — это генетически, метаболически и клинически гетерогенное заболевание, которое может быть обусловлено мутациями в разных генах, чаще в гене, кодирующем ключевой фермент метаболизма глюкозы — глюкокиназу [КФ 2.7.1.2] [3—7] (MODY2), и в генах, кодирующих факторы транскрипции регуляторной сети Р-клеток панкреатических островков Лангерганса, продуцирующих инсулин [1, 2, 5, 6] (MODY1 и MODY3).

Инактивирующие мутации гена глюкокиназы (GCK), приводящие в гетерозиготном состоянии к развитию диабета типа MODY2 (OMIM #125851), а в гомозиготном — к перманентному неонаталь-ному диабету (OMIM #606176), встречаются наиболее часто (http://www.ncbi.nlm.nih.gov/) [4—7]. В базу данных HGMD (Human Gene Mutation Database, http://www.hgmd.cf.ac.uk/) включено более 500 мутаций гена GCK, из них более 50 аннотированы как мутации сплайсинга.

Результаты первого молекулярно-генетиче-ского исследования MODY2 в России опубликованы в 2011 г. [8]. При дальнейшем анализе мутаций в гене GCK у российских больных MODY, наряду с нонсенс- и миссенс-мутациями, выявлены также замены, которые могут нарушать сплайсинг пре-мРНК глюкокиназы. В представленной работе охарактеризованы две такие мутации и с использованием системы экспрессии минигенов в культивируемых клетках человека подтверждено, что они нарушают нормальный сплайсинг и приводят к образованию аберрантных продуктов сплайсинга, а значит, могут стать причиной развития MODY2.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

В работе использовали штамм Escherichia coli JM109, рестрикционную эндонуклеазу EcoRI фирмы "Promega", ДНК-лигазу фага Т4, щелоч-

ную фосфатазу из кишечника теленка (CIAP) и Taq-ДНК-полимеразу фирмы "Fermentas" (Литва), олигонуклеотиды (таблица) фирмы "Синтол" (Россия). Все генноинженерные процедуры проводили согласно стандартным протоколам [9].

Идентификация мутаций в гене GCK. Суммарную ДНК из периферической крови выделяли с помощью набора WizardR Genomic DNA Purification Kit ("Promega").

Анализ мутаций в гене GCK проводили с помощью прямого секвенирования амплифицирован-ных фрагментов гена.

Амплификация и клонирование фрагментов геномной ДНК человека. Для получения минигенов GCK фрагменты геномной ДНК человека ампли-фицировали, используя ПЦР с парами праймеров GCK-E6F/GCK-E7R или GCK-E7F/GCK-E8R (таблица). Амплификацию проводили с использованием реагентов набора для высокоточной ПЦР (High Fidelity PCR Enzyme Mix фирмы "Fermentas") в условиях, рекомендованных изготовителем. Продукты ПЦР разделяли электрофорети-чески в 1%-ном агарозном геле и выделяли из геля, используя компоненты набора QIAquickR Gel Extraction Kit ("QIAGEN"). Выделенные фрагменты клонировали в векторе pGEMR—T Easy ("Promega"). Рекомбинантные клоны отбирали на чашках с агаризованной средой, содержащей ампициллин, изопропилтиогалактозид (ИПТГ) и 5-бромо-4-хлоро-3-индолил^^-галактопира-нозид (X-Gal). Присутствие вставок подтверждали с помощью ПЦР на колониях с праймерами M13F и M13R (таблица). Плазмиды из положительных клонов выделяли, используя наборы Plasmid Mini Kit ("QIAGEN"), и секвенировали с теми же праймерами.

Конструирование минигенов GCK. Фрагменты нормального и мутантных генов GCK вырезали из полученных плазмид рестриктазой EcoRI и встраивали в вектор pRK5, расщепленный EcoRI и обработанный CIAP. Клоны со вставками ми-нигенов в правильной ориентации по отношению к промотору цитомегаловируса (CMV) отбирали методом ПЦР на колониях с праймерами CMV и GCK-E7R или GCK-E8R. Плазмиды из положительных клонов выделяли и использовали для трансфекции клеток HEK293.

Трансфекцию клеток HEK293 (линия эпите-лиоподобных клеток почки эмбриона человека) проводили с использованием липофектамина ("Invitrogen™"). За 12—14 ч до трансфекции клетки линии HEK293 высевали в 24-луночный куль-туральный планшет по 50 тыс. на лунку, чтобы к моменту трансфекции плотность монослоя составляла 50—70%. На следующий день меняли культуральную среду на свежую среду DMEM без сыворотки и антибиотиков (400 мкл на лунку). Образцы ДНК разводили в 50 мкл такой же по составу среды из расчета 10 мкг/мл. Раствор липо-

Синтетические олигонуклеотиды, использованные в работе

Олигонуклеотид Нуклеотидная последовательность (5'^ 3') Число звеньев

GCK-E6F GTGAATGACACGGTGGCCAC 20

GCK-E7R AACTCGTCCAGCTCGCCGGA 20

GCK-E7F TCCGGCGAGCTGGACGAGTTC 21

GCK-E8R GCGCAGCTGCTCGGAGGCCT 20

M13F GCCAGGGTTTTCCCAGTCACGA 22

M13R GAGCGGATAACAATTTCACACAGG 24

CMV CGGTAGGCGTGTACGGTGGGA 21

pRK5-F CACTCCCAGGTCCAACTGC 19

SV40pA GAATAAACAAGTTGGGCCATGG 22

фектамина (Lipofectamine 2000 фирмы "Invitro-genTM") готовили в среде DMEM без сыворотки и антибиотиков, согласно протоколу производителя (1 мкл липофектамина и 49 мкл среды на лунку 24-луночного планшета) и инкубировали 5 мин при комнатной температуре. Растворы липофектамина и ДНК смешивали, инкубировали 20 мин при комнатной температуре для образования комплекса и добавляли к клеткам. Затем клетки помещали на 4 ч в С02-инкубатор (влажная атмосфера, 5% СО2, 37°C), после чего среду заменяли на DMEM, содержащую 10% эмбриональной сыворотки крупного рогатого скота, 4 мМ L-глутами-на, 1 мМ пирувата натрия, стрептомицин и пенициллин в концентрации 100 мкг/мл и 100 ед./мл соответственно. Через 48 ч клетки промывали фос-фатно-солевым буфером и выделяли из них РНК.

Выделение РНК и проведение ОТ-ПЦР. Суммарную РНК из культивируемых клеток выделяли с

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»