научная статья по теме ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ БАКТЕРИЙ РОДА LACTOBACILLUS ИЗ ГАСТРОИНТЕСТИНАЛЬНОЙ МИКРОБИОМЫ ЛЮДЕЙ Биология

Текст научной статьи на тему «ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ БАКТЕРИЙ РОДА LACTOBACILLUS ИЗ ГАСТРОИНТЕСТИНАЛЬНОЙ МИКРОБИОМЫ ЛЮДЕЙ»

= ГЕНЕТИКА МИКРООРГАНИЗМОВ

УДК 579.852.1:577.113

ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ БАКТЕРИЙ РОДА Lactobacillus ИЗ ГАСТРОИНТЕСТИНАЛЬНОЙ МИКРОБИОМЫ ЛЮДЕЙ

© 2010 г. С. Г. Ботина1' 2, Н. В. Коробан2, К. М. Климина1, А. А. Глазова1, Н. В. Захаревич1, В. В. Зинченко2, В. Н. Даниленко1

Учреждение Российской академии наук Институт общей генетики им. Н.И. Вавилова, Москва 119191;

e-mail: svetabotina@yahoo.com 2Московский государственный университет им. М.В. Ломоносова, кафедра генетики, Москва 119992

Поступила в редакцию 04.05.2010 г.

Изучено видовое и штаммовое генетическое разнообразие культур бактерий рода Lactobacillus, обладающих пробиотическими свойствами и выделенных в 1960—1980 гг. из гастроинтестинальной микробиомы людей, проживавших на территории бывшего СССР. С использованием филогенетического анализа определенных нами последовательностей гена 16S рРНК показано, что бактерии, выделенные из содержимого кишечника взрослых здоровых людей и представленные видами L. plantarum, L. helveticus, L. casei/paracasei, L. rhamnosus, L. fermentum, обнаруживают высокий процент гомологии этого гена с типовыми представителями видов — на уровне 97—100%. Изучено генетическое штаммовое разнообразие культур с использованием метода RAPD-ПЦР и неспецифических праймеров. Показано, что применение этой методики с использованием праймера ERIC-1 дает наиболее достоверные и воспроизводимые результаты по сравнению с использованием праймеров М13 и MSP и позволяет проводить идентификацию на видовом уровне и паспортизацию на штаммовом бактерий рассматриваемых видов рода Lactobacillus.

Бактерии рода Lactobacillus широко представлены в окружающей среде. Они обнаруживаются в продуктах питания растительного и животного происхождения, в различных ферментированных продуктах, в бытовых и промышленных отходах, на слизистых тканях наружных полостей всех млекопитающих, включая человека. Род Lactobacillus, согласно определителю Берджи, относится к классу Bacilli, отряду Lactobacillales, семейству Lactoba-cillaceae. Бактерии этого рода составляют незначительную часть микробиоты кишечника взрослого человека, приблизительно 0.01—0.6% от всех обитателей желудочно-кишечного тракта (ЖКТ). Преобладающими видами являются L. gasseri, L. crispatus, L. salivarius, L. ruminis, L. acidophilus, L.fermentum, L. casei, L. rhamnosus, L.johnsonii, L. plantarum, L. brevis, L. delbrueckii, L.curvatus и L. sakei [1, 2]. Большая часть выделяемых фекальных лактобацилл (по данным зарубежных исследований) принадлежит к видам L. gasseri, L. reuteri, L. crispatus, L. salivarius, L. rhamnosus и L. paracasei [2]. Лактобациллы наиболее активно осуществляют регуляторные функции внутри популяции кишечных бактерий и являются представителями нормальной микрофлоры кишечника здоровых людей. Сегодня в мире существует огромный интерес к пробиотикам и продуктам функционального питания. Пробиотическими бактериями чаще всего являются бифидобактерии и молочнокислые бактерии рода Lactobacillus, их называют классическими пробиотиками.

Цель работы — изучение видового и штаммо-вого генетического разнообразия культур лактобацилл, выделенных в 60-80-е годы прошлого века из содержимого кишечника здоровых людей, проживавших на территории бывшего СССР.

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы и условия культивирования. В работе исследовались 13 штаммов бактерий рода Lactobacillus (из коллекции ГКНМ Федерального государственного учреждения науки Московского научно-исследовательского института эпидемиологии и микробиологии им. Г.Н. Габричевского Роспотребнадзора (ФГУН МНИИЭМ им. Г.Н. Габричевского)), выделенных из содержимого кишечника здоровых людей. Список всех штаммов, использованных в работе, а также источник выделения и номера депонированных нами последовательностей их генов 16S рРНК приведены в табл. 1. Штаммы были идентифицированы нами на основании данных о ферментации сахаров (с использованием тест-системы API 50) и по результатам анализа нуклеотидной последовательности гена 16S рРНК. Биохимические характеристики исследуемых штаммов представлены в нашей предыдущей работе [3]. Культуры всех штаммов выращивали в жидкой и на агаризован-ной среде МРС производства "HiMedia" (Индия) в термостате при 37 ± 0.5°С в течение 24-48 ч. При выращивании бактерий на плотных пита-

1589

Таблица 1. Список штаммов, использованных в работе, информация о происхождении, номер депонированной нами последовательности гена 168 рРНК в GenBank NCBI

Видовая принадлежность штамма Название штамма Источник выделения* Номер депонированной последовательности в GenBank NCBI

L. plantarum CS 396 Содержимое кишечника здорового взрослого человека GU560031

L. plantarum 8РА-3 Вагина женщины, Эстония GU560032

L. plantarum 90ТС-4 Растительное происхождение, Эстония GU560033

L. plantarum ГКНМ 101 Содержимое кишечника здорового взрослого человека GU560034

L. helveticus Er 317/402 НАРИНЭ Содержимое кишечника здорового взрослого человека, Армения GU560035

L. helveticus 100 аш Содержимое кишечника здорового взрослого человека GU560036

L. helveticus NK-1 То же GU560037

L. helveticus NNIE » GU560038

L. casei ГКНМ 23 л1 » GU560039

L. casei ГКНМ 577 » GU560040

L. casei К3Ш24 » GU560041

L. rhamnosus 421-2 » GU560042

L. fermentum ГКНМ 526 » GU560043

* Коллекция МНИИЭМ им. Г.Н. Габричевского.

тельных средах применяли анаэростаты и газпаки фирмы "Био Мерье" (Франция), обеспечивающие атмосферу, содержащую 10% СО2. В качестве

Таблица 2. Референтные штаммы, последовательности которых использовались в филогенетическом анализе

Название штамма Номер депонированной последовательности в NCBI

E. coli str.K-12 substr.DH10B ECDH10B-0182

L. acidophilus NCFM LBA 2044

L. delbrueckii subsp. bulgaricus ATCC BAA-365 LBU Lr1597

L. brevis ATCC367 LVISr0082

L. helveticus DPC4571 lhv 3101

L. casei ATCC334 LSEI r2531

L. paracasei subsp. paracasei 8700 LBPG00323

L. paracasei subsp. paracasei ATCC25302 ACGY01000162

L. casei BL23 FM177140

L. plantarum JDM1 rRNA13

L. plantarum WCFS1 lpr RNA12

L. fermentum IFO 3956 LAF 16SrRNA04

L. rhamnosus ATCC 7469 AB008211

типовых культур в экспериментах по изучению штаммового генетического разнообразия были использованы культуры штаммов из коллекции ФГУН МНИИЭМ им. Г.Н. Габричевского (L. brevis DSM 20054, L. casei DSM 20011, L. fer-mentum DSM 20052, L. buchneri DSM 20057, L. del-brueckii DSM 20072, L. plantarum ATCC 8014). В качестве типовых штаммов при изучении генетического разнообразия на видовом уровне использовали нуклеотидные последовательности гена 16S рРНК штаммов лактобацилл, полная нуклео-тидная последовательность генома которых представлена в базе данных NCBI (табл. 2).

Анализ нуклеотидных последовательностей гена 16S рРНК. Для анализа полученных последовательностей гена использовали программу Blast в Internet (http://www.ncbi.nlm.nih.gov/blast). Результаты секвенирования анализировали с использованием компьютерной программы Vector NTI: ContigExpress. Множественное выравнивание последовательностей проводили в программе ClustalX (http://www.ebi.ac.uk/Tools/clustalw/in-dex.html); филогенетический анализ, расчет генетических дистанций, построение дендрограмм — в программе Mega4.0 в Internet (http://www.megas-oftware.net).

Проведение RAPD-ПЦР. При проведении RAPD-ПЦР использовали праймеры ERIC-1 (ATGTAAGCCTTCGGGGATTCAC) [4], MSP (GTAAAACGACGGCCAGT) [5] и M13 (GAGGG-TGGCGGTTCT) [6]. Каждую реакцию проводи-

ли в 20 мкл реакционной смеси, содержащей 20 нг хромосомной ДНК, 20 пмоль праймера, 250 мкМ каждого dNTP, 2 мМ MgCl2, 50 мМ KCl, 10 мМ трис-HCl (pH 8.8) и 1.25 единицы активности Тод-полимеразы. Реакцию проводили в ампли-фикаторе Omn-E фирмы "Hybaid", согласно тем-пературно-временному профилю, предложенному ранее [7]. Сначала образцы ДНК подвергали денатурации при 94°С в течение 2 мин. Затем проводили 40 циклов, включающих денатурацию ДНК при 94°С в течение 30 с, отжиг праймера при температуре 45°С в течение 30 с и полимеразную реакцию в течение 80 с. Заключительный этап элонгации проводили при 72°С в течение 4 мин. Праймеры синтезировали в фирме "Синтол". В работе использовали реактивы фирмы "Fermentas".

Электрофорез ДНК в агарозном геле. Гель-электрофорез ДНК проводили в горизонтальном 1.5% агарозном геле в трис-ацетатном буфере при напряженности электрического поля 0.5 В/см в течение 17 ч. Для визуализации ДНК гель окрашивали раствором бромистого этидия (0.05 мкг/мл в дистиллированной воде) в течение 30 мин. Для определения размеров фрагментов ДНК в качестве стандартов использовали ДНК-маркеры GeneRuler™ DNA Ladder Mix SM0331 фирмы "Fermentas".

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Филогенетический анализ последовательностей гена 16S рРНК изучаемых штаммов лактобацилл

Анализ нуклеотидных последовательностей проксимальной части гена 16S рРНК 13 исследуемых штаммов показал, что они принадлежат к пяти видам молочнокислых бактерий рода Lacto-bacillus: L. plantarum, L. helveticus, L. casei/para-casei, L. rhamnosus, L. fermentum. На рис. 1 представлено филогенетическое дерево, на котором все исследуемые нами штаммы располагаются кластерами. Так, штаммы, идентифицированные нами как L. helveticus (NK-1, 100 аш, Er 317/402 НАРИНЭ, NNIE), обнаруживают гомологию последовательностей гена 16S рРНК протяженностью в 500 нуклеотидов на уровне 99-100% между собой и на уровне 99-100% с последовательностью типового штамма L. helveticus DPC4571. Штаммы, принадлежащие к видам L. helveticus и L. acidophilus, чрезвычайно близки филогенетически, что и объясняет неверную первоначальную идентификацию изучаемых штаммов на основании физиолого-биохимических признаков как принадлежащих к виду L. acidophilus (см. [3]). Между тем гомология между последовательностями типового штамма L. acidophilus NCFM и изучаемых нами штаммов составляет 98%, а между последовательностями типовых штаммов L. helveticus DPC4571 и L. acidophilus NCFM, пред-

ставленных в нижней части рисунка (рис. 1), составляет 97%; это позволяет сделать заключение о возможности использования проксимальной части последовательности данного гена для идентификации двух близкородствен

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»