научная статья по теме КЛОНИРОВАНИЕ И ФУНКЦИОНАЛЬНАЯ ЭКСПРЕССИЯ КДНК ХИТИНАЗЫ ИЗ МОЛИ - МИНЕРА ЛИСТЬЕВ ЯБЛОЧНОГО ДЕРЕВА (LITHOCOLLETIS RINGONIELLA) Химия

Текст научной статьи на тему «КЛОНИРОВАНИЕ И ФУНКЦИОНАЛЬНАЯ ЭКСПРЕССИЯ КДНК ХИТИНАЗЫ ИЗ МОЛИ - МИНЕРА ЛИСТЬЕВ ЯБЛОЧНОГО ДЕРЕВА (LITHOCOLLETIS RINGONIELLA)»

БИОХИМИЯ, 2015, том 80, вып. 2, с. 296 - 304

УДК 577.152.3

КЛОНИРОВАНИЕ И ФУНКЦИОНАЛЬНАЯ ЭКСПРЕССИЯ кДНК ХИТИНАЗЫ ИЗ МОЛИ - МИНЕРА ЛИСТЬЕВ ЯБЛОЧНОГО ДЕРЕВА (ЬиНосаНеОк пщвтеНи)

© 2015 Кс.-Дж. Фан*, У.-Кс. Май, Х. Рен, Ч. Жанг, Я. Лай, Кс.-Кс. Ксиан

Тайюаньский технологический университет, Колледж химии и химической инженерии, Департамент биологической и фармацевтической инженерии, Китай; факс: +86(351)601-8534, электронная почта: fxjbio@163.com

Поступила в редакцию 21.07.14 После доработки 19.09.14

Хитиназа насекомых играет важную роль в катаболизме хитина, связанном с перевариванием и линькой насекомого в период его развития. В настоящей работе проведено клонирование кДНК хитиназы (ЬгСЫ5>) из минера яблочного листа (ЬШосоИвШ пщотв11а) и определены аминокислотная последовательность и свойства белка. Длина кДНК хитиназы Ь. пщотвИа насчитывала 2136 п.о. при открытой рамке считывания, равной 1737 п.о., и кодировала белок, состоящий из 579 а.о. с расчетной мол. массой 64,4 кДа и р15,49. В каталитическом домене находится несколько сайтов фосфорилирования и гликозилирования. Рекомбинант-ный ЬгСМ5 экспрессировали в линиях клеток. и ЬгСМ5, экспрессированные в клетках насекомых, обладали хитинолитической активностью. ЬгСЫ:5 был наиболее стабилен при рН 6 и 45°. Результаты настоящей работы могут быть использованы для разработки новых, более эффективных, синтетических ингибиторов хитиназы с перспективой их применения в качестве биоинсектицидов.

КЛЮЧЕВЫЕ СЛОВА: ЬШосоИвШ пщотвИа, хитиназа, ИАСЕ-ПЦР, ферментативная активность.

Хитин является нерастворимым полисаха-ридным полимером, образованным остатками Р-(1,4)-^-ацетилглюкозамина; он жизненно необходим для образования кутикулы насекомого и перитрофной мембраны (peritrophic membrane — PM) [1]. Во время роста и развития насекомого кутикула и перитрофная мембрана подвергаются протеолизу и обновлению, что обеспечивает его рост, созревание и восстановление [2—3]. Деградирующие хитин ферменты принимают участие в сбрасывании старой кутикулы и обновлении перитрофной мембраны [4]. Расщепляющая на концах хитиназа и расщепляющая внутренние связи р-^-ацетилглюкозаминидаза являются двумя основными ферментами, участвующими в деградации хитина. Основные функции хитиназ связаны с их участием в переваривании, процессе линьки членистоногих, защите и патогенности, в связи с тем, что они осуществляют гидролиз р-1,4-связей с хитином с образованием низкомолекулярных продуктов

Принятые сокращения: RACE — быстрая амплификация концов кДНК; LrCht — хитиназа из Lithocolletis ringoniel-la; п.о. — пар оснований; а.о. — аминокислотные остатки.

* Адресат для корреспонденции.

[5—6]. Хитиназы насекомых образуют семейство из 18 гликогидролаз в соответствии с их консервативной аминокислотной последовательностью, несколькими консервативными мотивами и мультидоменной структурой [3]. Значимость хитина для развития насекомых вызвала большой интерес к хитиназам как потенциальным мишеням для разработки молекул инсектицидов для защиты урожаев и лесов от насекомых-вредителей [7].

Работы, посвященные изучению хитиназ насекомых на белковом уровне, публикуются, начиная с 1970-х гг. Первая полноцепочечная кДНК, кодирующая хитиназу насекомых, была выделена из рогатой гусеницы табачного листа (Manduca sexta) [8]. Затем были клонированы дюжины кодирующих хитиназы кДНК из многих видов насекомых, включая мух, молей и жуков [9—12]. Доступность информации о полных геномах насекомых облегчила поиск сходства их последовательностей, что ускорило проведение исследований хитиназ насекомых на генетическом уровне [13].

Хитиназа была экспрессирована в трансгенных растениях и рекомбинантных бакуловиру-сах и было показано ее влияние на контроль за

вредителями [14—16]. Например, Маккаферти и соавт. в 2006 г. сообщили, что трансгенные растения папайи, в клетках которых экспрессиру-ется белок хитиназан из M. sexta, более устойчивы к паучьим клещам [17]. Хитиназы насекомых также могут быть использованы для облегчения распространения рекомбинантных бакуловиру-сов путем переваривания хитин-содержащих препятствий. Гопалакришнан и соавт. показали, что значение LT50 насекомых, инфицированных рекомбинантным бакуловирусом AcMNPV-chi, было на 18—20 ч меньше в сравнении с насекомыми, инфицированными вирусом дикого типа [14], в этом случае инсерция хитиназы могла бы повысить эффективность действия бакуловируса. Исследования, выполненные в нашей лаборатории, также показали, что хитиназа из M. sexta может быть использована для усиления инсектицидной активности рекомбинантного бакуло-вируса [18].

Чтобы еще повысить эффективность хити-наз насекомых как потенциальных инсектицидов, необходимо узнать больше об этих ферментах [19—20]. В настоящей работе было проведено клонирование кДНК, кодирующей активную хитиназу из Lithocolletis ringoniella (Gracilariidae), вредителя фруктов. Информация по хитиназам этого семейства практически отсутствует в отличие от других семейств молей. Мы использовали бакуловирусную векторную систему экспрессии и получили рекомбинантную хитиназу из L. ringoniella с удельной активностью, сравнимой с активностью хитиназы, экспрессированной в E. coli. Далее мы приводим полученные данные о хити-назе из L. ringoniella.

МЕТОДЫ ИССЛЕДОВАНИЯ

Содержание насекомых и сбор тканей. Яйца минера яблочных листьев (L. ringoniella) собирали в яблочных садах неподалеку от г. Юнчен в провинции Шанкси (Китай). Яйца (молочного цвета) находились на обратной стороне листьев, они были посажены на специальную диету, приобретенную в RIFE (Китайская лесная академия), при 26° и световом режиме 12 ч — на свету, 12 ч — в темноте. Подвергнутые анестезии личинки были разрезаны в ледяном солевом растворе, содержащем 0,75%-ный NaCl и кутикулы получали из организмов, находящихся на стадии предкуколки. Ткани промывали для удаления загрязнений и замораживали в жидком азоте для дальнейшего использования.

Получение РНК и синтез кДНК. РНК получали из кутикул личинок на стадии предкуколки, используя реагент RNAiso Plus («TaKaRa», Китай),

согласно инструкциям производителя. Проверку осуществляли электрофорезом в 1%-ном ага-розном геле и количество белка определяли на приборе Thermo Scientific Multiskan GO («Thermo Fisher Scientific», США). кДНК первой цепи синтезировали с использованием 1 мкг общей PНК с помощью набора TIANScript™ RT Kit («Tiangen Biotech Cо.», Китай).

Амплификация фрагмента кДНК. Вырожденные праймеры (таблица) были сконструированы согласно консервативным аминокислотным последовательностям DWEYPG и WAIDMD из каталитического участка хитиназы насекомых. ПЦP проводили в следующих условиях: исходная денатурация при 95° 2 мин, затем З2 цикла при 95° 30 с, 5Q° 1 мин и при 72° 45 с и заключительной денатурации при 72° 1Q мин. Продукт амплификации получали путем электрофореза в 1%-ном агарозном геле, окрашивали этидиум бромидом и очищали с использованием набора Gel Extraction Kit («Omega Bio-Tek», США). Очищенный фрагмент подвергали дополнительному клонированию в pEASY-Blunt векторе с использованием набора pEASY-Blunt cloning kit («TransGen Biotech Co.», Китай). Позитивные клоны характеризовали с помощью ПЦP и некоторые из этих клонов секвенировали в «Sangon» (Китай).

Быстрая амплификация концов кДНК (RACE).

Последовательность З'-концевого участка LrCht5 была амплифицирована с использованием набора З'-RACE kit («Life Technology», Китай) в соответствии с инструкциями производителя. В качестве матрицы для З'-RACE ПЦP синтез первой цепи кДНК был инициирован на по-ли(А)-содержащем хвосте мPНК с использованием адаптора З'-конца праймера (таблица). В З'-RACE ПЦP был использован специфичный праймер GSP1 (таблица) (который отжигается с консервативным участком) и универсальный амплификационный прайм ер UAP (таблица). ПЦP осуществляли при следующих условиях: исходная денатурация при 95° 1 мин, 25 циклов при 95° 1 мин, 55° 1 мин, 72° 2 мин и заключительной элонгации при 72° 1Q мин. Вложенная ПЦP была проведена с использованием UAP и GSP2 (на 47 п.о. ниже GSP1), с использованием продукта ПЦP, полученного в результате первой амплификации в качестве матрицы.

Для амплификации 5'-концевой последовательности гена LrCht5 был использован ген-специфичный праймер (GSP — gene specific primer) (таблица) как праймер обратной транскрипции. До начала 5'-RACE амплификации фрагмент поли^) был лигирован к З'-концу кДНК гена LrCht5 с помощью терминальной дезоксинукле-отидилтрансферазы («TaKaRa», Китай). кДНК с

Праймеры, использованные для амплификации LrCht5

Праймер Последовательность (5' ^ 3') Примечание

Вырожденный F GAYTGGGAGTACCCHGG консервативный участок

Вырожденный R TCCATRTCRATRGCCCA консервативный участок

З'-адаптор GGCCACGCGTCGACTAGTAC (T)18 3'-race транскрипция

UAP GGCCACGCGTCGACTAGTAC 3'-race амплификация

GSP1 TGGCGATCCTGCTCCGTACAC 3'-race амплификация

GSP2 ACAAAGAAGGCTCAGGCTG 3'-race амплификация

GSP TCCTTGATCCAGTTCATCTTGATCT 5'-race транскрипция

5'-адаптор CGCTACGTAACGGCATGACAGTG(C)16 5'-race амплификация

GSP3 TCGTACGACATCACGTGGATAGC 5'-race амплификация

LrCht5F ATGAGAGTGATACTAGCGACGTTG LrCht5 ORF

LrCht5R CAGTTTAGGGCTCGCAGTCACTAC LrCht5 ORF

P1Cht5F CAGGAATTCATGAGAGTGATACTAGCGACGTTGG LrCht5 ORF прокариотической и эукарио-тической экспрессии

P2Cht5R TACAAGCTTTTAGGGCTCGCAGTCACTACGGTC LrCht5 ORF прокариотической экспрессии

P3Cht5R TACCTGCAGTTAATGATGATGATGATGATGGGGC-TCGCAGTCACTACGGT LrCht5 ORF эукариотической экспрессии

Примечание. Сайты рестрикции подчеркнуты одной линией, 6 х His-tag отмечен двойным подчеркиванием. Символы «Y», «R» и «H» в вырожденных праймерах означают C/T, A/G и A/C/T соответственно.

прикрепленным поли(С) хвостом затем была амплифицирована с помощью ПЦР с использованием сокращенного заякоривающего праймера 5'-адаптора и GSP3, находящимися на 410 п.о. выше GSP. Оба продукта З'-RACE и 5'-RACE были очищены и секвенированы.

Сквозная амплификация полной кодирующей последовательности LrCht5. После определения 3'- и 5'-концевых последовательностей LrCht5 праймеры LrCht5F и LrCht5R были использованы для амплификации полной открыто

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Химия»