научная статья по теме МОЛЕКУЛЯРНАЯ ИЗМЕНЧИВОСТЬ ГЕНОВ SHUTTLE CRAFT И LIM3, КОНТРОЛИРУЮЩИХ РАЗВИТИЕ НЕРВНОЙ СИСТЕМЫ, В ПРИРОДНОЙ ПОПУЛЯЦИИ DROSOPHILA MELANOGASTER Биология

Текст научной статьи на тему «МОЛЕКУЛЯРНАЯ ИЗМЕНЧИВОСТЬ ГЕНОВ SHUTTLE CRAFT И LIM3, КОНТРОЛИРУЮЩИХ РАЗВИТИЕ НЕРВНОЙ СИСТЕМЫ, В ПРИРОДНОЙ ПОПУЛЯЦИИ DROSOPHILA MELANOGASTER»

ГЕНЕТИКА, 2008, том 44, № 9, с. 1172-1177

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА

УДК 575.17:595.773.4

МОЛЕКУЛЯРНАЯ ИЗМЕНЧИВОСТЬ ГЕНОВ shuttle craft И Lim3, КОНТРОЛИРУЮЩИХ РАЗВИТИЕ НЕРВНОЙ СИСТЕМЫ, В ПРИРОДНОЙ ПОПУЛЯЦИИ Drosophila melanogaster

© 2008 г. А. В. Симоненко, О. Ю. Рыбина, Е. Г. Пасюкова

Институт молекулярной генетики Российской академии наук, Москва 123182;

e-mail: egpas@rambler.ru Поступила в редакцию 12.09.2007 г.

Представлены данные, позволяющие охарактеризовать сравнительный полиморфизм первого эк-зона и первого интрона генов stc и Lim3, а также последовательностей, примыкающих к этим генам с 5'-конца и предположительно являющихся регуляторными, на примере 20 секвенированных природных аллелей. Сравнение генов stc и Lim3 показывает, что по уровню полиморфизма их интроны, изменчивость которых находится на уровне, характерном для Drosophila melanogaster, сходны между собой, в то время как предполагаемая регуляторная область и первый экзон гена stc более вариабельны, чем соответствующие районы гена Lim3. Поскольку исследованные гены находятся в одних и тех же хромосомах, выделенных из одной и той же популяции, и расположены недалеко друг от друга в районе с высокой частотой рекомбинации, различный уровень полиморфизма, характерный для их регуляторных и кодирующих частей, объясняется индивидуальными особенностями каждого гена. Полученные данные свидетельствуют также о том, что уровень полиморфизма в кодирующей части исследованных генов поддерживается балансирующим отбором.

Измерение уровня генетической изменчивости в природных популяциях является традиционной задачей популяционной генетики. В течение последних десяти лет, начиная с пионерской работы Мориямы и Пауэлла [1], происходило накопление данных об исходном и наиболее информативном уровне изменчивости - уровне первичных последовательностей ДНК различных генов. Критерии выбора генов для исследования различны, но, как правило, интерес вызывает важность функциональной роли генов в контроле основных метаболических путей [2], репродуктивного процесса [3], передачи регуляторных сигналов [4, 5], развития [6], старения [7].

Ранее использование методов рекомбинацион-ного и делеционного картирования и комплемен-тационных тестов с мутациями позволило нам выделить две интересные группы генов, связанные с ранее неизвестными путями контроля продолжительности жизни [8]. Первая группа представлена генами, участвующими в биосинтезе ка-техоламинов и передаче нервного импульса в нейронах; вторую группу составляют гены, кодирующие транскрипционные факторы РНК-поли-меразы II, которые участвуют в контроле развития и функционирования мотонейронов. В последнюю группу входят гены stc [9] и Ьш3 [10], выбранные нами для исследования молекулярной изменчивости в природных популяциях дрозофилы.

Ген ^с был открыт и описан у дрозофилы около десяти лет тому назад [11, 12]. Он является единственным известным гомологом фактора транскрипции №-Х1 человека. Этот ген локализован во второй хромосоме, в цитологической позиции 35С2, имеет размер 4589 пар нуклеотидов (пн) и состоит из пяти экзонов и четырех небольших интронов. Два транскрипта гена различаются на 21 пн вследствие альтернативного сплайсинга первого интрона. Белок 8ТС имеет: РНК-свя-зывающий домен (ИБ); домен, обусловливающий белок-белковые взаимодействия (7Р_КШв); домен, необходимый для связывания двунитевой ДНК (7Р_№-Х1), и домен для связывания одно-нитевых нуклеиновых кислот (ИЗН). Экспрессия зк наблюдается в течение всей жизни. В эмбрионах зк экспрессируется в центральной нервной системе и необходим для поддержания правильного роста аксонов мотонейронов. Мутации гена летальны и проявляются в том, что эмбрион не способен к вылуплению вследствие нарушения иннервации мышц и отсутствия перистальтических мышечных сокращений. У взрослых мух максимальная экспрессия наблюдается в яичниках, что необходимо для нормального развития эмбрионов следующего поколения.

Ген Ыш3 идентифицирован в 1999 г. [13, 14]. Он локализован во второй хромосоме, в цитологической позиции 37В13-37С1 и имеет размер 28874 пн. Мажорный транскрипт гена состоит из семи экзонов и шести интронов и имеет размер

6374 пн. Белок LIM3 содержит два LIM-домена и гомеодомен (HD) на C-конце, а также домен LSD, характерный только для LIM3-подсемейства LIM-гомеодоменных белков. Экспрессия Lim3 наблюдается главным образом в эмбрионах. Она сосредоточена в мотонейронах определенного типа. Предполагается, что Lim3 является одним из ключевых генов для идентификации типа мотонейронов в развитии. Мутации гена летальны.

В данной статье представлены первые результаты проводимой работы, цель которой - охарактеризовать сравнительный полиморфизм первого экзона и первого интрона генов stc и Lim3, а также последовательностей, примыкающих к этим генам с 5'-конца и предположительно являющихся регуляторными.

МАТЕРИАЛЫ И МЕТОДЫ

Линии Drosophila melanogaster. Материалом для исследования природного полиморфизма послужили линии, полученные в лаборатории Труди Мак-кей (Государственный университет Северной Каролины, США) [7]. Каждая из линий содержит индивидуальную вторую хромосому из природной популяции Raleigh в однородном генетическом окружении (изогенная линия Samarkand).

Выделение ДНК. ДНК выделяли из 25 особей каждой линии согласно ранее описанному протоколу [15]. Мух гомогенизировали в 700 мкл лизи-рующего буфера, содержащего SDS ("Sigma") и протеиназу К ("Promega"), инкубировали 3 ч при 55°C, далее обрабатывали РНКазой ("Sigma") в течение 10 мин при комнатной температуре, а затем проводили стандартную фенол-хлороформную экстракцию и преципитацию этанолом. Выделенную ДНК растворяли в 50 мкл бидистилли-рованной воды.

Полимеразная цепная реакция (ПЦР). Для получения исследуемого фрагмента ДНК нужной длины и последующего его секвенирования проводили ПЦР. Реакцию ПЦР проводили в 50 мкл реакционной смеси следующего состава: 70 мМ трис-HCl, pH 8.6; 16.6 мМ (NH4)2SO4; 2 мМ MgCl2; 0.4 мМ каждого из четырех нуклеотидов; по 20 пмоль каждого праймера; 2.5 единицы Taq-по-лимеразы; 0.5 единицы Р/м-полимеразы (все реактивы фирмы "Силекс") и около 0.5 мкг ДНК матрицы. Последовательности праймеров для гена stc: CTAATTGGAAGGCGGAGCTC и CAT-TGAGAGTCCGGTGCTCT, для гена Lim3: TC-CAACCAGACTGTCAAGTCAAATTAC и TTGCA-GAAAGAGAATAA-CGCTAAATCA. Результаты полимеразной цепной реакции проверяли с помощью аналитического электрофореза в нативном агарозном геле.

Секвенирование. Для секвенирования использовали по 2 мкл полученных амплификатов, об-

работанных фосфатазой SAP ("Promega") и экзо-нуклеазой ExoI (New England BioLabs). Секвенирование проводили с помощью набора реактивов Big Dye Terminator V. 3.1. ("Applied Biosystems") согласно инструкции фирмы.

Праймеры для секвенирования выбирали на расстоянии 400-450 пн друг от друга. Последовательности праймеров для гена stc: CTAATTGGAAGGCGGAGCTC, AAGCCACATTTGAAGT-TGCA, AAAGACGCACAAATCGCCGC, GAAAC-CGTATCAGTGCTCCG, ACCCTTCTCAGCAATC-TCAG, GAACCGTTGCAGTACATTTAAC; для гена Lim3: TCCAACCAGACTGTCAAGTCAAAT-TAC, TTCAATTAGCATGATCCAAGG, AGACGT-TGCT-CTCGATCAGC, AGACCACTCCCCGAA-AACTG, ATGTCAGCCCCTGTATGTGC.

Пробы очищали с помощью колонок CentriSep ("Princeton Separations"), а затем высушивали при 65°С в течение 2 ч. Далее пробы передавали для секвенирования в Центр определения последовательности нуклеотидов ДНК Институтов Секции общей биологии ОБН РАН (Институт общей генетики им. Н.И. Вавилова РАН). Результаты секвенирования обрабатывали с помощью компьютерных программ ChromasPro (1.34, Technelysium Pty Ltd., 2003-2006) и Vector NTI (9.0, InforMax, 1994-2003).

Обработка результатов. Уровень полиморфизма оценивали с помощью общепринятых показателей: п - наблюдаемая средняя доля нуклео-тидных различий между секвенированными аллелями и б - среднее число сегрегирующих нуклеотидов на сайт. В качестве теста на селективную нейтральность выявленного полиморфизма использовали показатель D Таджимы [16]. Для вычисления этих показателей, а также для оценки параметров рекомбинации и неравновесия по сцеплению между выявленными полиморфными сайтами использовали программу DnaSP 4.0 [17].

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

В работе было исследовано 20 хромосом из природной популяции Raleigh, и в каждой из этих хромосом была определена последовательность нуклеотидов как гена shuttle craft (stc), так и гена Lim3. Таким образом, последующий анализ основывается на данных о молекулярной структуре 20 природных аллелей генов stc и Lim3, находящихся в одних и тех же хромосомах, выделенных из одной и той же популяции.

Выборка хромосом, использованная в данной работе, невелика. В настоящее время в аналогичных работах используются выборки от 15 до 250 и даже более секвенированных природных аллелей. Важно подчеркнуть, однако, что размер выборки определяется задачами исследования. Например, увеличение выборки с 16 до 54 аллелей

I II I

межгенная область

GC15269

II I II I

Lim3

экзон интрон stc

I II II

11 I II

интрон

экзон

межгенная область

экзон

интрон

Структура исследованных областей генов stc и Lim3 и расположение выявленных полиморфных сайтов. Блоки черного цвета обозначают экзоны генов, серого - интроны, белого - окружающие последовательности. Стрелки обозначают расположение выявленных полиморфных сайтов.

не выявило значительного числа новых полиморфных сайтов в гене Delta [4]. В целом же показано, что увеличение выборки до величины, превышающей 20 аллелей, не изменяет существенно показатели генетического разнообразия, хотя для теста на нейтральность несколько большая выборка дает более гомогенные результаты [5].

Для секвенирования были выбраны первый экзон и первый интрон каждого из двух исследованных генов, а также протяженная последовательность, находящаяся перед каждым геном (рисунок). В случае Lim3 это первый экзон, соответствующий мажорному транскрипту гена, а прилежащая к нему на 5'-конце область является фрагментом протяженного (более 22000 пн) интрона минорного транскрипта, однако для основного транскрипта она эквивалентна межгенной области, потенциально содержащей регулятор-ные элементы,

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Биология»