научная статья по теме НОВЫЕ МУТЕИНЫ ФАКТОРА НЕКРОЗА ОПУХОЛЕЙ ЧЕЛОВЕКА С ДОМИНАНТНО-НЕГАТИВНЫМИ СВОЙСТВАМИ Химия

Текст научной статьи на тему «НОВЫЕ МУТЕИНЫ ФАКТОРА НЕКРОЗА ОПУХОЛЕЙ ЧЕЛОВЕКА С ДОМИНАНТНО-НЕГАТИВНЫМИ СВОЙСТВАМИ»

БИОХИМИЯ, 2010, том 75, вып.. 12, с. 1679 - 1686

УДК 577.112.017

НОВЫЕ МУТЕИНЫ ФАКТОРА НЕКРОЗА ОПУХОЛЕЙ ЧЕЛОВЕКА С ДОМИНАНТНО-НЕГАТИВНЫМИ СВОЙСТВАМИ*

© 2010 г. Л.Н. Шингарова1**, Е.Ф. Болдырева1, С.А. Якимов1, С.В. Гурьянова1, Д.А. Долгих1,2, С.А. Недоспасов2,3, М.П. Кирпичников1,2

1 Учреждение РАН Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН, 117997Москва, ул. Миклухо-Маклая, 16/10; факс: (495)330-6983, электронная почта: кЫщ@ mx.ibch.ru

2 Биологический факультет МГУ им. М.В. Ломоносова, 119991 Москва; факс: (495) 330-6983, электронная почта: dolgikh@nmr.ru 3 Учреждение РАН Институт молекулярной биологии им. В.А. Энгельгардта РАН, 119991 Москва, ул. Вавилова, 32

Поступила в редакцию 30.06.10 После доработки 14.07.10

Фактор некроза опухолей (ФНО) — полифункциональный цитокин, один из основных медиаторов воспаления и врожденного иммунитета. С другой стороны, системные или локальные повышенные концентрации фактора некроза опухолей характерны для таких патологических состояний, как ревматоидный артрит, псориаз, болезнь Крона, септический шок и рассеянный склероз. При некоторых заболеваниях нейтрализация активности фактора некроза опухолей дает ярко выраженный клинический эффект, поэтому поиск различных блокаторов фактора некроза опухолей остается перспективным направлением белковой инженерии и биотехнологии. Следуя разработанной ранее концепции о возможности получения доминантно-негативных мутеинов фактора некроза опухолей, были изучены мутантные варианты фактора некроза опухолей: ФНОУ87Н + А145Я, ФНОУ87Н + А968 + А145Я и ФНОУ9Ш + А145Я, образующие неактивные гетеротримеры с природным белком. Исследована способность мутантов нейтрализовать действие фактора некроза опухолей. Показано, что добавление мутеинов к природному белку обеспечивает зависимое от концентрации мутантного варианта подавление цитотоксического действия фактора некроза опухолей на клетки мышиных фибробластов Ь929. Таким образом, на основе этих белков могут быть сконструированы новые ингибиторы фактора некроза опухолей человека.

КЛЮЧЕВЫЕ СЛОВА: фактор некроза опухолей-альфа человека (ФНО), мутанты, ингибиторы ФНО.

Фактор некроза опухолей-альфа человека (ФНО) — полифункциональный цитокин, один из центральных медиаторов воспаления, врожденного иммунитета и функций защиты организма, а также структурной организации лим-фоидных органов [1, 2]. У человека ФНО синтезируется преимущественно активированными макрофагами, В- и Т-лимфоцитами и МК-клет-ками в виде трансмембранного гомотримера с

Принятые сокращения: ФНО — фактор некроза опухолей человека; TNFRI, TNFRII — рецепторы ФНО; ДН-ФНО — доминант-негативные ингибиторы ФНО.

* Первоначально английский вариант рукописи был опубликован на сайте «Biochemistry» (Moscow), Papers in Press, BM10-191, 14.11.2010.

** Адресат для корреспонденции.

молекулярной массой мономеров 26 кДа. Этот белок расщепляется специфической металло-протеазой. В результате процессинга получается тримерная форма растворимого ФНО, мономер которой имеет молекулярный вес 17 кДа и состоит из 157 аминокислотных остатков (а.о.) [3, 4]. Разнообразие биологических свойств ФНО опосредовано двумя высокоаффинными рецепторами, ТОТШ (р55) и TNFR.II (р75), которые связывают ФНО с примерно равной аффинностью [5], причем с рецепторами связывается и передает внутриклеточный сигнал как растворимая, так и мембранная форма белка. Имеются экспериментальные свидетельства того, что именно растворимая форма ФНО связана с хроническими воспалительными процессами [6]. Многие аутоиммунные и воспалительные забо-

1679

левания человека сопровождаются локальной или системной сверхпродукцией ФНО, которая приводит к патологическим состояниям, включая септический шок. Повышенное содержание ФНО в крови было обнаружено при различных заболеваниях человека, таких как: церебральная малярия, менингококовый менингит, ревматоидный артрит, псориаз, болезнь Крона, рассеянный склероз и др. Исследования, проведенные в течение последних лет, показали, что ингибиро-вание связывания белка ФНО с рецепторами имеет ярко выраженный клинический эффект у пациентов с воспалительными заболеваниями неинфекционной этиологии. Наиболее эффективными ингибиторами оказались специфичные к ФНО антитела и рекомбинантные полипептиды, в состав которых входили антигенсвя-зывающие домены антител, специфичных к рецепторам этого цитокина. На основе таких полипептидов получены препараты Инфликси-маб, Этанерсепт, Ленерсепт и другие, которые успешно прошли клинические испытания [7], однако использование этих препаратов достаточно дорого в силу высоких затрат на производство и может сопровождаться рядом побочных эффектов. Поэтому дальнейший поиск недорогих антагонистов ФНО является перспективным направлением белковой инженерии и биотехнологии. Ранее группой исследователей из США было показано, что некоторые мутанты ФНО могут взаимодействовать с природным белком, образуя неактивные гетеротримеры и нейтрализуя таким образом его активность [8]. В развитие этой концепции нами получены новые мутанты ФНО с повышенной способностью к гетеротримеризации, которые потенциально являются блокаторами нового типа — аутоблока-торами.

МЕТОДЫ ИССЛЕДОВАНИЯ

В работе использовали штаммы E.coli XL-1 Blue (Stratagene) и E. coliBL21(DE3) («Novagen»), а также штамм E. coli SG20050 [9]. Олигонуклео-тиды синтезированы фирмой «Евроген» (Россия).

Клонирование рекомбинантных ДНК проводили в клетках E. coli XL-1 Blue стандартными методами [10]. Использовали рестриктазы, ДНК-лигазу, Taq- и Pfu-полимеразы фирмы «Fermentas» (Литва). Конструирование генов мутантных вариантов ФНО проводили методом splice overlap extension PCR (SOE-PCR). Амплификацию проводили с использованием Pfu-по-лимеразы в условиях, рекомендованных производителем фермента. Параметры ПЦР: 3 мин денатурации матрицы при 95°; 25 циклов (дена-

турация 95° 45 с, отжиг праймеров 52—55° 45 с, элонгация 72° 45 с); достройка 72° 5 мин. Плаз-миду рший, кодирующую белок ФНОУ87И + + Л145Я, получали путем амплификации ДНК плазмиды рТМР331, содержащей ген ФНО [9], с помощью мутагенизирующих праймеров:

CATCGCCGTCTCCСACCAGACCAAGGTC (871),

GACCTTGGTCTGGTGGGAGACGGCGATG (87г),

CGACTATCTCGACTTTCGCGAGTCTGGG-CAG (1451)

CTGCCCAGACTCGCGAAAGTCGAGATAG-TCG (145г).

Во второй ступени ПЦР использовали праймеры: TCGATAAATTCGGTACCTAA

и

TTCATTAAGCTTCACAGGGCAATGATCCC

к 5'- и З'-концам гена ФНО.

После обработки рестриктазами С/а1 и ИтйIII и очистки в 1%-ном агарозном геле продукт амплификации клонировали в вектор, полученный путем обработки ДНК плазмиды pTNF331 этими же рестриктазами. Для получения плазмиды рши12, кодирующей белок ФНОУ87И + A96S + A145R, амплификацию проводили аналогичным образом на матрице ршиИ с праймерами CTCCTCTCTТCCЛTCAA-GЛGC(961) и GCTCTTGЛTGGЛGЛGЛG GЛG(96г) в первой ступени ПЦР. Плазмиду рши13, кодирующую ФНОV91N + A145R, получили амплификацией pTNF331 в присутствии мутагенизи-рующих праймеров:

CGЛCTЛTCTCGЛCTTTCGCGЛGTCTGGG-CAG (1451)

CTGCCCЛGЛCTCGCGAAЛGTCGЛGЛTЛG-TCG (145г),

CAGACCAAGAACAACCTCCTCTCT (91N1)

и

GЛGGЛGGTTGTTCTTGGTCTGGTЛ (91Nг).

Клонирование проводили в плазмиду pTNF331 как описано выше. Для получения плазмиды pETTNF, кодирующей ФНО с гексагистидино-

вой последовательностью на N-конце, ген ФНО амплифицировали в присутствии праймеров TTCATTGCTAGCTCGAGCCGAACCCCG и TTCATTAAGCTTCACAGGGCAATGATCCC и клонировали в плазмиду pET28a (Novagen) по сайтам узнавания рестриктаз NheI и HindIII. Строение плазмид подтверждали рестриктным анализом и секвенированием (ЦКП «Геном»).

Выделение белков. Клетки штамма E. coli SG2GG5G, трансформированные pTNF331, pmut1, pmut2, или pmut3, выращивали в 2GG мл LB с ампициллином (1GG мкг/мл) при 37° в течение 18 ч. Биомассу после центрифугирования суспендировали в буфере 1, содержащем 2G hM фосфат калия, рН 7,G, 15G мМ NaCl, Ю%-ную сахарозу и 1G мкг/мл PMSF, и разрушали клетки обработкой ультразвуком. Суспензию после озвучивания центрифугировали, осадок отбрасывали, су-пернанант диализовали против буфера 2 (5G мМ фосфат натрия, рН 7,5 и 1G мкг/мл PMSF) и наносили на колонку с гидроксиапатитом (2G мл) (гидроксиапатит Bio-Gel HTP, «Bio-Rad»). Разделение проводили в линейном градиенте концентрации фосфата натрия (5G-3GG мМ). Фракции, содержащие рекомбинантный белок, собирали, диализовали против буфера 3 (2G мМ Tris-HCl, рН 7,5 или рН 8,G для мутантных белков) и наносили на колонку (1G мл) с DEAE-целлюло-зой (DEAE-ToyoPeari 650M, «Toyo Soda», Япония). Целевой белок элюировали линейным градиентом NaCl (G—G,15 М) в буфере 3 и стерилизовали фильтрацией через фильтры MILLEX G,22 mm (Millipore). (His)6ФНО выделяли из клеток штамма E. coli BL21(DE3) («Novagen»), трансформированных плазмидой pETTNF. Клетки выращивали в 2GG мл LB c ампициллином (1GG мкг/мл) при 37° до OD56G G,5—G,7 и индуцировали добавлением G,2 мМ ИПТГ, после чего продолжали культивирование в течение 3 ч. Биомассу после центрифугирования суспендировали в буфере 4 (5G мМ Tris-HCl, рН 8,G, 1 мМ PMSF, 2GG мМ NaCl) и разрушали клетки обработкой ультразвуком. К супернатанту добавляли имидазол до 1G мМ, наносили на колонку (1 мл) Ni-Sepharose FastFlow («GE Healthcap»), уравновешенную этим же буфером, промывали буфером 4 с 2G мМ имидазола и элюировали буфером 4, содержащим 3GG мМ имидазол. Фракции, содержащие гибридный белок, объединяли, после чего диализовали против буфера 5 (2G мМ Tris-HCl, рН 7,5, 1GG мМ NaCl) и стерилизовали. Концентрацию гибридных белков определяли при помощи реагента Protein Assay («Bio-Rad»). Выход очищенных ФНО и мутантов из 1 г биомассы составлял 8—1G мг, (His)6ФНО — 12 мг.

Получение гетеротримеров ФНО с мутантными белками. 2G мкг (His)6ФНО смешивали с 2G мкг

мутантного белка (ФНОУ87Н + A145R, ФНОУ87Н + A96S + A145R, ФНОУ9Ш + A145R) или ФНО и инкубировали в буфере, содержащем 100 мМ NaCl и 20 мМ Tris-HCl, рН 7,5 1 ч при 37° + 18 ч при 4°. Продукты обмена выделяли на аналитических колонках Ni-NTA Spin Columns («Qiagen») по протоколу производителя. Выделенные гетеротримеры анализировали при помощи белкового эле

Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.

Показать целиком

Пoхожие научные работыпо теме «Химия»