МОЛЕКУЛЯРНАЯ БИОЛОГИЯ, 2012, том 46, № 6, с. 894-899
МОЛЕКУЛЯРНАЯ БИОЛОГИЯ КЛЕТКИ
UDC 577
THE INFLUENCE OF OPIOID PEPTIDES ON MATRIX METALLOPROTEINASE-9 AND UROKINASE PLASMINOGEN ACTIVATOR EXPRESSION IN THREE CANCER CELL LINES
© 2012 K. Gach1, A. Wyrgbska1, J. Szemraj2, A. Janecka1*
department of Biomolecular Chemistry, Medical University of Lodz, Lodz 92-215, Poland 2Department of Biochemistry, Medical University of Lodz, Lodz 92-215, Poland
Received January 31, 2012 Accepted for publication March 06, 2012
Matrix metalloproteinases (MMPs) and urokinase plasminogen activator (uPA) regulate proteolysis of the extracellular matrix (ECM) and as a consequence are involved in a number of physiological and pathological states, including cancer. A crucial feature of cancer progression and metastasis is the disruption of the ECM and spreading of proliferating cancer cells. Over-expression of MMPs and uPA is common for most types of cancers and correlates well with the adverse prognosis. Compounds able to modulate the activity of these pro-teolytic enzymes may become important agents in cancer therapy. In the present study, we examined the effect of the д-opioid receptor selective peptide, morphiceptin, and its two synthetic analogs on mRNA and protein levels of MMP-9 and uPA in three human cancer cell lines: MCF-7, HT-29, and SH-SY5Y. Our findings indicate that in all three cell lines morphiceptin and its analogs attenuated MMP-9 expression and secretion and that this effect is not mediated by opioid receptors but is under control of the nitric oxide system. On the other hand, tested opioids up-regulated uPA levels through a mechanism that involved opioid-receptors. Different pathways by which opioid peptides exert their action in cancer cells can explain their contradictory influence on the level of cancer markers.
Keywords: opioid peptides, biochemical markers, ELISA, RT-PCR, nitric oxide synthase.
Tumor metastasis is a multistep process consisting of several sequential events including detachment of malignant cells from the primary tumor, invasion into the surrounding tissues, intravasation into the circulatory system, adhesion to vascular endothelial cells at distant sites, and extravasation through the endothelial basement membrane to colonize new tissues. The most critical step of metastasis formation is the invasion of cancer cells through the extracellular matrix (ECM), which surrounds the endothelium or creates the basement membrane of epithelial tissue in different organs [1]. The key proteases that are involved in the degradation of ECM are plasmin, uPA and matrix metalloproteinases (MMPs) [2, 3], especially MMP-2 (gelatinase A) and MMP-9 (gelatinase B), which possess the ability to degrade type IV collagen, one of the major components of basement membranes. Expression and activity of all of these enzymes undergo changes in many pathological conditions, including inflammation, degenerative disorders, and cancer. A
Abbreviations: ECM — extracellular matrix; eNOS — endothelial nitric oxide synthase; GAPDH — glyceraldehyde 3-phos-phate dehydrogenase; MMPs — matrix metalloproteinases; MMP-2 - gelatinase A; MMP-9 - gelatinase B; NO - nitric oxide; PBS — phosphate buffered saline; uPA — urokinase plasminogen activator.
The text was submitted by the author(s) in English. * E-mail: anna.janecka@umed.lodz.pl
simple relationship has been established between overproduction of MMPs in tumor cells and cancer progression [4, 5]. Similarly, uPA is believed to mediate cancer dissemination by catalyzing the ECM degradation, thus allowing malignant cells to spread in an uncontrollable way to distant sites. uPA levels have been shown to be up-regulated in most types of cancer [6—9] and correlate well with an adverse prognosis [10—12].
Indeed, preclinical experiments have demonstrated that interference with the proteolytic pathways in cancer cells may inhibit their invasive activity in in vitro assays and significantly decrease their invasion and metastatic spreading in animals and humans [13—15]. These observations prompted different studies with various inhibitors designed to block the proteolytic activity of enzymes involved in the ECM degradation and can open a new area for the use of such compounds as therapeutic agents.
Opioids are often administered to cancer patients in order to relieve pain. Presence of opioid receptors on tumor cells has prompted experimental studies investigating the effect of opioids on various regulatory factors that can affect cell proliferation and their migration potential.
This study was designed to test the effect of three opioid peptides, morphiceptin and its two analogs, on MMP-9 and uPA expression and secretion levels in
three cancer cell lines, MCF-7, HT-29 and SH-SY5Y, and to elucidate the possible mechanism of their action in cancer cells.
EXPERIMENTAL
Opioid peptides. Morphiceptin (Tyr-Pro-Phe-Pro-NH2) and its two analogs, [Dmt1, D-Ala2, D-1-Nal3]morphiceptin (analog 1) and [Dmt1, D-NMeAla2, D-1-Nal3]morphiceptin (analog 2) were synthesized in our laboratory using a standard solid-phase method, as described previously [16].
Cell cultures. The MCF-7 human breast adenocarcinoma, HT-29 colon and SH-SY5Y neuroblastoma cancer cell lines were purchased from the European Collection of Cell Cultures (ECACC). All cell lines were cultured according to the manufacturer's instructions in culture mediums supplemented with gentamycin (5 ^g/mL) and 10% heat inactivated fetal bovine serum (both from "Biological Industries", Israel). Cells were maintained at 37° C in a 5% CO2 atmosphere and grown until they were 80% confluent.
Incubation with opioids. The MCF-7, HT-29 or SH-SY5Y cells (5 x 104 cells/mL) were seeded in 25 ml cell culture flasks in 10 mL of standard growth medium. After 24 h, the growth medium was replaced by a fresh growth medium supplemented with the tested compounds to a concentration of 0.1 ^M. Cells incubated without a tested compound were used as a control. After 48 h of incubation, the cells for mRNA isolation were washed twice with phosphate buffered saline (PBS; "Invitrogen", USA) to remove added compounds and were then harvested by trypsinolysis. The cells were frozen in RNAlater ("Sigma-Aldrich", USA) and kept at —80°C till further experiments. For the determination of MMP-9 and uPA protein levels in the medium, the culture supernatant was collected, cleared by centrifugation and stored at —20°C.
Quantitative real-time PCR assay. Total RNA was extracted from the MCF-7, SH-SY5Y or HT-29 cells using a Total RNA Mini Kit ("A&A Biotechnology", Poland) according to the manufacturer's protocol. The concentration and purity of the isolated RNA were determined spectrophotometrically at 260 and 280 nm. cDNA was synthesized using an Enhanced Avian HS RT-PCR Kit and oligo (dT)12-18 primers ("Sigma-Aldrich"). Expression levels of the MMP-9, uPA and endothelial nitric oxide synthase (eNOS) genes, as well as of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), used as a house-keeping gene, were quantified by real-time PCR using an Mx3005P QPCR Systems ("Agilent Technologies, Inc. Santa Clara", USA) according to the manufacturer's instructions for the Brilliant II SYBR Green QPCR Master Mix ("Agilent Technologies, Inc. Santa Clara"). cDNA was amplified with forward and reverse primers that were specific for human MMP-9, uPA, eNOS and GAPDH genes. MMP-9 primer se-
quences were 5' GACCAATCTCACCGACAGG 3' (forward) and
5' GCCACCCGAGTGTAACCATA 3' (reverse). uPA primer sequences were
5' GACCCCCTCGTCTGTTCCCTCCAAG 3' (forward) and 5' CTCTTCCTTGGTGTGACTGCGG 3' (reverse). eNOS primer sequences were
5' CAGCCCTCAGAGTACAGCAAGT 3' (forward) and
5' CCATCTCGGGTGTGGTAGGTG 3' (reverse).
As an internal control, GAPDH was amplified using primer sequences
5'-GTCGCTGTTGAAGTCAGAGGAG-3' (forward) and
5' CGTGTCAGTGGTGGACCTGAC-3' (reverse).
Real-time PCR reactions were run in triplicate using the following thermal cycling profile: 95°C for 10 min, followed by 40 steps of 95°C for 30 s and 58°C for 1 min and 72°C for 1 min. After 40 cycles the samples were run according to the dissociation protocol (i.e. melting curve analysis). Brilliant II SYBR Green fluorescence emission was registered and mRNA levels were quantified using the critical threshold (Ct) value. Relative standard curves were generated for the tested genes with serial 10-fold dilutions of the cDNA sample. Controls with no cDNA template were included with each assay. The obtained values were normalized relative to the GAPDH transcript levels. All results are presented as mean ±SD.
MMP-9 and uPA secretion. The supernatant collected after treating the cells with the test compound was subsequently analyzed for MMP-9 and uPA protein levels using the MMP-9 ELISA Kit ("RayBiotech", USA) and AssayMax Human Urokinase (uPA) ELISA Kit ("AssayPro, USA), respectively, according to the manufacturer's instructions.
NO secretion. The NO concentration in culture medium after treating the cells with opioids was determined using the Nitric Oxide Quantitation Kit ("Active Motif", USA) according to the manufacturer's instructions.
Statistical analysis. Statistical analysis was performed using Prism 4.0 ("GraphPad Software Inc.", USA). Data were expressed as means ± SD. Differences between groups were assessed by a one-way ANOVA followed by a post-hoc multiple comparison Student-Newman-Keuls test. Student's i-test was used to compare single treatment means with control means. A probability level of 0.05 or lower was considered statistically significant.
RESULTS
MMP-9 mRNA levels and MMP-9 secretion in cancer cells incubated with opioids
The MMP-9 mRNA expression levels were measured using quantitative RT-PCR. The MCF-7, HT-
MO^EK^MPHAa EHO^Oraa TOM 46 № 6 2012
896
GACH и др.
< §°.4
S
9
pi 0.3
о 0.2
й
св
É^ 0.1
о >
о 0 Рй
125
ад100 й
Рч 75
«53 50 0> ел
I 25 РЙ
а □ Control
EZ3 Morphiceptin ^ Analog 1 ^ Analog 2
É
***
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.