ФИЗИОЛОГИЯ РАСТЕНИЙ, 2015, том 62, № 1, с. 111-118
^_ЭКСПЕРИМЕНТАЛЬНЫЕ
СТАТЬИ
УДК 581.1
TOMATO Tm-22 GENE CONFERS MULTIPLE RESISTANCES TO TMV, ToMV,
PVX, AND PVY TO CULTIVATED POTATO1
© 2015 Z. Hu, G. Liu, J. Gao, Ch. Zhang, X. Wu, Q. Xie, G. Chen
Bioengineering College, Chongqing University, Chongqing, P.R. China Received May 16, 2014
Viral infection seriously affects the yield and quality of potato tubers. Breeding of virus-resistant potato (Solanum tuberosum L.) varieties is essential. Introduction of resistance genes from other Solanaceae species into cultivated potato is likely to be a valuable method to achieve durable resistance to potato virus. Tm-22 resistance gene was cloned from tomato cv. KBV and introduced into the binary vector pBIN19 to yield Tm-22-constitutive expression vector under the control of the CaMV 35S promoter. The resultant vector was transferred into potato, and Tm-22 gene was successfully expressed in transgenic potato plants. After infection with TMV, ToMV, PVX, and PVY, transgenic potato plants showed the high level of resistance to these viruses, and potato tuber yield was significantly increased compared to wild type. qRT-PCR results showed that Tm-22 transgenic plants had much lower transcript levels of VIRUS-COAT genes than wild type, even no TMV- and ToMV-COAT RNAs were detected in upper non-inoculated systemic leaves of transgenic lines. These results indicate that Tm-22 confers different resistance responses against viruses depending on its expression level.
Keywords: Solanum tuberosum ssp. tuberosum - Tm-22gene - cultivated potato - virus resistance
DOI: 10.7868/S0015330315010078
INTRODUCTION
In terms of global production, potato (Solanum tuberosum L.) is the fourth most important food crop after rice, wheat, and corn. China is now the biggest potato producer, and almost a third of all potato is harvested in China and India. Asian consumption represents almost half of the world potato supply. Potato plays a great role in developing countries with its ability to provide nutritious food for the poor and hungry. However, viral infection seriously affects the yield and quality of potato tubers, and it is a main factor of degradation of potato varieties. Potato virus X (PVX) and potato virus Y (PVY) are the main virus pathogens of potato plants in China, and in some areas tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) can also infect potato plants. Thus, anti-virus breeding
1 This text was submitted by the authors in English.
Abbreviations'. CaMV - cauliflower mosaic virus; CP - coat protein; ER - extreme resistance; HR - hypersensitive response; MP - movement protein; NPTII - neomycin phosphotransferase II; NRT - no reverse transcription control; NTC - no template control; PBS - phosphate-buffered saline; PVX - potato virus X; PVY - potato virus Y; R gene - resistance gene; SHR - systemic hypersensitive response; TMV - tobacco mosaic virus; ToMV - tomato mosaic virus; qRT-PCR - quantitative real-time PCR. Corresponding author. Chen Guoping. Bioengineering College, Chongqing University, Campus A, 174 Shapingba Main Street, Chongqing, 400044, P.R. China; fax. +8 623 6511-2674; e-mail. chenguoping@cqu.edu.cn
is particularly important in potato production. Due to the autopolyploidy and highly heterozygous nature associated with the potato genome, breeding progress and crop improvement are time-consuming and labor intensive, when using conventional breeding methods. Although virus-free technology of potato tips, widely used in cultivation at present, could significantly reduce the incidence of virus diseases, virus-free tubers might be infected during their cultivation in the field. Since 1986, a number of anti-virus potato varieties have been generated by transferring virus genes into potato, such as viral coat protein (CP), viral movement protein (MP), and viral replicase genes [1-4]. However, an incoming viral genome, which could be encapsulated by the coat protein produced from the transgenes, could result in risks of virus-resistant transgenic crops [5, 6].
Recently, a few virus resistance genes have been isolated from wild potato species, such as Ny-1 and Eval for resistance to PVY [7, 8], Rx1 and Rx2 for resistance to PVX [9]. Introducing Ny-1 and Eval genes into cultivated potato conferred PVY resistance to transgenic potato plants [7, 8]. At present, no genetic source of resistance against tobamoviruses has been identified in potato and no tobamovirus-resistant potato variety has been developed. The Tm-22 gene was originally isolated from tomato and conferred extreme resistance (ER) against TMV and ToMV by recogniz-
Primes used in this study
Name Primer (5'—3')
Tm-F GGATCCTTGGCCGTGGACTCCATCT
Tm-R GTCGACCACTACTACACTCACGTTGC
NP-F CTATGACTGGGCACAACAGACAAT
NP-R CAATATCACGGGTAGCCAACG
Oligo(dT)18 TTTTTTTTTTTTTTTTTT
Actin-F TGAACACGGAATTGTCAGCA
Actin-R GGGGTTAAGAGGGGCTTCAG
TMV-COAT-F GTTAGGTTCCCTGACAGTGA
TMV-COAT-R ACCGTTGCGTCGTCTACTCT
ToMV-COAT-F GTCATCTGTATGGGCTG
ToMV-COAT-R GTTCTTGCTTGCTGTGT
PVX-COAT-F AAGCCTGAGCACAAATTCGC
PVX-COAT-R GCTTCAGACGGTGGCCG
PVY-COAT-F GGGTTTAGCGCGTTATGCC
PVY-COAT-R TCTTGTGTACTGATGCCACCG
Tom-F TGTTATAGAGATTATGGAC
Tom-R CACTCCCAGTATACCCAG
ing viral movement proteins. Tm-22-mediated resistance has been successfully used for decades to protect tomato plants against ToMV infection [10]. Potato and tomato belong to the Solanaceae plant family. They have close genetic relationship. Introducing Tm-22 gene from tomato into cultivated potato is considered a good method to achieve durable resistance to tobam-ovirus disease.
In this paper we cloned the Tm-22 resistance gene from tomato cv. KBV and constructed Tm-22-constitu-tive expression vector. The transgenic potato was generated by Agrobacterium--mediated transformation. After infection with TMV ToMV, PVX, and PVY, transgenic potato showed high resistance to these viruses.
MATERIALS AND METHODS
Plant materials and virus strains. The tomato cv. KBV was a kind gift from Prof. Donald Grierson, Nottingham University. The virus-free potato (Solanum tuberosum ssp. tuberosum, cv. E-potato 3, 2n = 4x = 48) and the virus strains TMV, ToMV, PVX, and PVY were kindly provided by the potato engineering and technology research center of Chongqing. E-potato 3 is a susceptible host for ToMV, TMV, PVX, and PVY, and it was used for genetic transformation.
Cloning Tm-22 gene and plasm id construction.
Based on the sequence of tomato resistance gene Tm-22 reported in GenBank (AF536201), specific primers Tm-F/Tm-R (table) were designed to amplify the full-length cDNA of Tm-22 from the tomato cv. KBV. This cDNA fragment was linked in the sense ori-
entation between the 35S promoter and terminator of Cauliflower Mosaic Virus (CaMV) in pDH51. Subsequently, the expression cassette digested from pDH51 was linked into the binary vector pBIN 19 to yield pBIN19- Tm-22 (fig. 1). The resulted vector was identified by restriction enzyme digestion and sequencing and transferred to Agrobacterium tumefaciens strain LBA4404 by the freeze-thaw method [11].
Microtuber induction and plant transformation.
Some improvements were made based on the potato transformation methods previously reported [12-19]. First, 60 stem segments with a leaf or more leaves of the virus-free potato cv. E-potato 3 were used as the explants cultured on an induction medium (MS + + 8% sucrose + 2 mg/L 6-benzylaminopurine + + 0.6% agar, pH 5.9) in darkness for about 6-8 weeks to get potato microtubers. 28 potato microtubers were then cut into potato chips about 5 mm thick and submerged in the resuspension solution (MS + A. tumefaciens strain LBA4404 harboring pBIN19-Tm-22 plas-mid, OD600 ~ 1.8-2.0) for 10 min. After absorbing the suspension liquid outside with filter paper, the potato chips were put onto co-culturing medium (MS + + 3% sucrose + 1 mg/L 4-indol-3-ylbutyric acid + + 2 mg/L zeatin + 0.2 mg/L gibberellic acid + + 0.5 mg/L 6-benzylaminopurine + 0.8% agar, pH 5.9) for two days in darkness. Subsequently, the potato chips were transferred onto selective medium (MS + + 3% sucrose + 1 mg/L 4-indol-3-ylbutyric acid + + 2 mg/L zeatin + 0.2 mg/L gibberellic acid + + 0.5 mg/L 6-benzylaminopurine + 500 mg/L carbe-nicillin + 75 mg/L kanamycin + 0.8% agar, pH 5.9).
RB
_L
t
Nos-pro
CaMY35S-pro 1
NPT II
t
Tm-22
CaMY35S-ter LB 1
Nos-ter
pBIN19-Tm-22
Fig. 1. Schematic representation of the T-DNAs derived from binary vector pBIN19.
RB — right border; Nos-pro — nopaline synthase gene promoter; NPTII - neomycin phosphotransferase gene; Nos-ter - no-paline synthase terminator; CaMV35S-pro — cauliflower mosaic virus 35S promoter; Tm-22 — Tm-22 coding sequence; CaMV35S-ter — cauliflower mosaic virus 35S terminator; LB — left border.
Two to three weeks later, 7 adventitious bud differentiation occurred. The adventitious buds were transferred onto rooting medium (MS + 3% sucrose + 200 mg/L carbenicillin + 50 mg/L kanamycin + 0.8% agar, pH 5.9) for 4-5 weeks to obtain healthy transgenic plantlets with roots. Finally, three transgenic lines were transplanted into soil and grown in a growth room with supplementary lighting under 16 h light/8 h dark cycle. The transgenic plants were detected with primers NP-F and NP-R (table).
Quantitative real-time PCR analysis. Total RNA was extracted using TRIzol reagent ("Invitrogen", United States) according to the manufacturer's instructions. The first-strand complementary DNA (cDNA) was synthesized using an M-MLV reverse transcriptase ("Takara", China) with oligo(dT) 18 primers (table). Quantitative real-time PCR (qRT-PCR) was carried out using the CFX96™ Real-Time System (C1000™ Thermal Cycler). Reactions were performed in triplicate using the SYBR® Premix Ex Taq II kit ("Takara") in a 10 ^L of total sample volume (5 ^L of 2x SYBR® Premix Ex Taq, 1 ^L of primers, 1 ^L of cDNA, and 3 ^L of ddH2O). To remove the effect of genomic DNA and the template from environment, NTC (no
Для дальнейшего прочтения статьи необходимо приобрести полный текст. Статьи высылаются в формате PDF на указанную при оплате почту. Время доставки составляет менее 10 минут. Стоимость одной статьи — 150 рублей.